Rh2BG662700

Cleavage site for pathogenic type III effector avirulence factor Avr

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr2B
OG0005964
Physical Location & Seq
Reverse (-)
87698971 .. 87700182
1212 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh2BG662700.1

Sequence Viewer

Length: 210 bp
ATGGCATCGCAAGATACAGGAAGACCTCTGCCGAAATTTGGAGAGTGGGATGTGAACAATCCAGCCTCGGCCGAAGGGTTTACAGTGATATTTAGCAAAGCTAGAGACCAGAAAATGAACAATGGACCCGGGAACTCGAAAAAGCATTCATTTAAGCCCCAAAACAACAGTGATGATGCCCCAAAGAAAAAGCTTTTCTGCTGTTTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
AvrRpt-cleavage

Protein Analysis

69

Amino Acids

7.66

Weight (kDa)

9.34

Isoelectric Point (pI)

20.9

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
AvrRpt-cleavage PF05627 7 - 39 1.3e-18 Cleavage site for pathogenic type III effector avirulence factor Avr
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 69
AcsI RAATTY 1 cut(s) 35
AfiI CCNNNNNNNGG 1 cut(s) 38
AluBI AGCT 2 cut(s) 101, 193
AluI AGCT 2 cut(s) 101, 193
Alw26I GTCTC 1 cut(s) 99
Ama87I CYCGRG 1 cut(s) 128
AoxI GGCC 1 cut(s) 69
ApoI RAATTY 1 cut(s) 35
AspS9I GGNCC 1 cut(s) 125
AsuC2I CCSGG 2 cut(s) 129, 130
AvaI CYCGRG 1 cut(s) 128
AvaII GGWCC 1 cut(s) 125
BbsI GAAGAC 1 cut(s) 28
BcnI CCSGG 2 cut(s) 129, 130
BcoDI GTCTC 1 cut(s) 99
BfaI CTAG 1 cut(s) 102
Bme1390I CCNGG 2 cut(s) 129, 130
Bme18I GGWCC 1 cut(s) 125
BmeT110I CYCGRG 1 cut(s) 128
BmgT120I GGNCC 1 cut(s) 125
BmiI GGNNCC 1 cut(s) 127
BmrFI CCNGG 2 cut(s) 129, 130
BmsI GCATC 2 cut(s) 14, 166
BpiI GAAGAC 1 cut(s) 28
BpuMI CCSGG 2 cut(s) 129, 130
BsaI GGTCTC 1 cut(s) 99
BsaJI CCNNGG 2 cut(s) 66, 128
Bsc4I CCNNNNNNNGG 1 cut(s) 38
BseDI CCNNGG 2 cut(s) 66, 128
BseGI GGATG 1 cut(s) 55
BseLI CCNNNNNNNGG 1 cut(s) 38
BseX3I CGGCCG 1 cut(s) 69
Bsh1285I CGRYCG 1 cut(s) 72
BshFI GGCC 1 cut(s) 71
BsiEI CGRYCG 1 cut(s) 72
BsiHKCI CYCGRG 1 cut(s) 128
BsiSI CCGG 1 cut(s) 129
BslI CCNNNNNNNGG 1 cut(s) 38
BsmAI GTCTC 1 cut(s) 99
BsmI GAATGC 1 cut(s) 145
BsnI GGCC 1 cut(s) 71
Bso31I GGTCTC 1 cut(s) 99
BsoBI CYCGRG 1 cut(s) 128
BspANI GGCC 1 cut(s) 71
BspLI GGNNCC 1 cut(s) 127
BspTNI GGTCTC 1 cut(s) 99
BssECI CCNNGG 2 cut(s) 66, 128
Bst4CI ACNGT 2 cut(s) 85, 170
BstF5I GGATG 1 cut(s) 55
BstMAI GTCTC 1 cut(s) 99
BstMCI CGRYCG 1 cut(s) 72
BstSCI CCNGG 2 cut(s) 127, 128
BstV2I GAAGAC 1 cut(s) 28
BstZI CGGCCG 1 cut(s) 69
BsuRI GGCC 1 cut(s) 71
BtsCI GGATG 1 cut(s) 55
BtsIMutI CAGTG 2 cut(s) 90, 175
Cfr13I GGNCC 1 cut(s) 125
Cfr9I CCCGGG 1 cut(s) 128
CviJI RGCY 5 cut(s) 65, 71, 101, 157, 193
CviKI_1 RGCY 5 cut(s) 65, 71, 101, 157, 193
EaeI YGGCCR 1 cut(s) 69
EagI CGGCCG 1 cut(s) 69
EclXI CGGCCG 1 cut(s) 69
Eco31I GGTCTC 1 cut(s) 99
Eco47I GGWCC 1 cut(s) 125
Eco52I CGGCCG 1 cut(s) 69
Eco88I CYCGRG 1 cut(s) 128
FokI GGATG 1 cut(s) 62
FspBI CTAG 1 cut(s) 102
HaeIII GGCC 1 cut(s) 71
HapII CCGG 1 cut(s) 129
HindIII AAGCTT 1 cut(s) 191
HpaII CCGG 1 cut(s) 129
Hpy166II GTNNAC 2 cut(s) 55, 81
Hpy8I GTNNAC 2 cut(s) 55, 81
HpyAV CCTTC 1 cut(s) 68
HpyCH4III ACNGT 2 cut(s) 85, 170
LpnPI CCDG 4 cut(s) 3, 75, 122, 142
LweI GCATC 2 cut(s) 14, 166
MaeI CTAG 1 cut(s) 102
MboII GAAGA 1 cut(s) 33
MluCI AATT 1 cut(s) 35
MnlI CCTC 2 cut(s) 36, 76
MseI TTAA 1 cut(s) 153
MspI CCGG 1 cut(s) 129
MspR9I CCNGG 2 cut(s) 129, 130
Mva1269I GAATGC 1 cut(s) 145
NciI CCSGG 2 cut(s) 129, 130
NlaIV GGNNCC 1 cut(s) 127
NmeAIII GCCGAG 1 cut(s) 47
PctI GAATGC 1 cut(s) 145
PspN4I GGNNCC 1 cut(s) 127
PspPI GGNCC 1 cut(s) 125
SaqAI TTAA 1 cut(s) 153
Sau96I GGNCC 1 cut(s) 125
ScrFI CCNGG 2 cut(s) 129, 130
SetI ASST 3 cut(s) 28, 103, 195
SfaNI GCATC 2 cut(s) 14, 166
SinI GGWCC 1 cut(s) 125
SmaI CCCGGG 1 cut(s) 130
Sse9I AATT 1 cut(s) 35
SspMI CTAG 1 cut(s) 102
StyD4I CCNGG 2 cut(s) 127, 128
TaaI ACNGT 2 cut(s) 85, 170
TaqI TCGA 1 cut(s) 137
TasI AATT 1 cut(s) 35
Tru1I TTAA 1 cut(s) 153
Tru9I TTAA 1 cut(s) 153
TscAI CASTG 2 cut(s) 90, 175
TspDTI ATGAA 2 cut(s) 131, 138
TspMI CCCGGG 1 cut(s) 128
TspRI CASTG 2 cut(s) 90, 175
VpaK11BI GGWCC 1 cut(s) 125
XapI RAATTY 1 cut(s) 35
XmaI CCCGGG 1 cut(s) 128
XspI CTAG 1 cut(s) 102
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.