MD14G1165000.v1.1

RPM1-interacting protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr14
OG0005964
Physical Location & Seq
Forward (+)
25890566 .. 25892341
1776 bp
Loading structure...
UTR
Exon/CDS
Intron
MD14G1165000.v1.1.491

Sequence Viewer

Length: 252 bp
ATGGCTTCGGATAAAGGTCGGCCGCTGCCGAAGTTCGGGGAATGGGACGTAAATAACCCAGCTTCAGCTGAAGGATTTACTGTTATCTTCAACAAGGCCAGAGATGAGAAGAAGACCAGCGCGGCTCAAGTGAAGATCGTCACCCCACGAAAAAATGACGGCAGCCTAAGAAATGGTGCTGGATACAACACTGTCAATGAGCACTATCCCAAGTATCCTCCCCCAAAGAAGAAATGGTTTTGCTGTGGCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
AvrRpt-cleavage

Protein Analysis

84

Amino Acids

9.26

Weight (kDa)

9.65

Isoelectric Point (pI)

21.76

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
AvrRpt-cleavage PF05627 5 - 38 3.7e-20 Cleavage site for pathogenic type III effector avirulence factor Avr
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 122
AciI CCGC 2 cut(s) 23, 122
AcoI YGGCCR 1 cut(s) 20
AcuI CTGAAG 2 cut(s) 48, 90
AfiI CCNNNNNNNGG 1 cut(s) 35
AgsI TTSAA 1 cut(s) 91
AluBI AGCT 2 cut(s) 62, 68
AluI AGCT 2 cut(s) 62, 68
Alw21I GWGCWC 1 cut(s) 204
AoxI GGCC 2 cut(s) 20, 96
ApeKI GCWGC 2 cut(s) 25, 162
AspLEI GCGC 1 cut(s) 122
AsuHPI GGTGA 1 cut(s) 133
BbsI GAAGAC 1 cut(s) 119
Bbv12I GWGCWC 1 cut(s) 204
BbvI GCAGC 2 cut(s) 12, 174
BceAI ACGGC 1 cut(s) 175
BciVI GTATCC 2 cut(s) 176, 225
BfuI GTATCC 2 cut(s) 176, 225
BisI GCNGC 4 cut(s) 23, 26, 123, 163
BlsI GCNGC 4 cut(s) 24, 27, 124, 164
BpiI GAAGAC 1 cut(s) 119
BpuEI CTTGAG 1 cut(s) 111
Bsc4I CCNNNNNNNGG 1 cut(s) 35
BseLI CCNNNNNNNGG 1 cut(s) 35
BseX3I CGGCCG 1 cut(s) 20
BseXI GCAGC 2 cut(s) 12, 174
BseYI CCCAGC 1 cut(s) 58
Bsh1236I CGCG 1 cut(s) 122
Bsh1285I CGRYCG 1 cut(s) 23
BshFI GGCC 2 cut(s) 22, 98
BsiEI CGRYCG 1 cut(s) 23
BsiHKAI GWGCWC 1 cut(s) 204
BslFI GGGAC 1 cut(s) 59
BslI CCNNNNNNNGG 1 cut(s) 35
BsmFI GGGAC 1 cut(s) 59
BsnI GGCC 2 cut(s) 22, 98
Bsp1286I GDGCHC 1 cut(s) 204
Bsp143I GATC 1 cut(s) 135
BspACI CCGC 2 cut(s) 23, 122
BspANI GGCC 2 cut(s) 22, 98
BspFNI CGCG 1 cut(s) 122
BssMI GATC 1 cut(s) 135
Bst4CI ACNGT 2 cut(s) 82, 193
BstDEI CTNAG 1 cut(s) 167
BstFNI CGCG 1 cut(s) 122
BstHHI GCGC 1 cut(s) 122
BstKTI GATC 1 cut(s) 138
BstMBI GATC 1 cut(s) 135
BstMCI CGRYCG 1 cut(s) 23
BstUI CGCG 1 cut(s) 122
BstV1I GCAGC 2 cut(s) 12, 174
BstV2I GAAGAC 1 cut(s) 119
BstZI CGGCCG 1 cut(s) 20
BsuI GTATCC 2 cut(s) 176, 225
BsuRI GGCC 2 cut(s) 22, 98
BtsIMutI CAGTG 1 cut(s) 189
CfoI GCGC 1 cut(s) 122
CviJI RGCY 8 cut(s) 5, 22, 62, 68, 98, 125, 165, 249
CviKI_1 RGCY 8 cut(s) 5, 22, 62, 68, 98, 125, 165, 249
DdeI CTNAG 1 cut(s) 167
DpnI GATC 1 cut(s) 137
DpnII GATC 1 cut(s) 135
EaeI YGGCCR 1 cut(s) 20
EagI CGGCCG 1 cut(s) 20
EclXI CGGCCG 1 cut(s) 20
Eco52I CGGCCG 1 cut(s) 20
Eco57I CTGAAG 2 cut(s) 48, 90
FaqI GGGAC 1 cut(s) 59
Fnu4HI GCNGC 4 cut(s) 23, 26, 123, 163
Fsp4HI GCNGC 4 cut(s) 23, 26, 123, 163
GlaI GCGC 1 cut(s) 121
GluI GCNGC 4 cut(s) 23, 26, 123, 163
GsaI CCCAGC 1 cut(s) 62
HaeIII GGCC 2 cut(s) 22, 98
HhaI GCGC 1 cut(s) 122
Hin6I GCGC 1 cut(s) 120
HinP1I GCGC 1 cut(s) 120
HphI GGTGA 1 cut(s) 133
Hpy188I TCNGA 1 cut(s) 10
HpyAV CCTTC 1 cut(s) 65
HpyCH4III ACNGT 2 cut(s) 82, 193
HpyCH4IV ACGT 1 cut(s) 48
HpyF3I CTNAG 1 cut(s) 167
HpySE526I ACGT 1 cut(s) 48
HspAI GCGC 1 cut(s) 120
Kzo9I GATC 1 cut(s) 135
LpnPI CCDG 4 cut(s) 72, 112, 130, 165
Lsp1109I GCAGC 2 cut(s) 12, 174
MaeII ACGT 1 cut(s) 48
MaeIII GTNAC 1 cut(s) 139
MalI GATC 1 cut(s) 137
MboI GATC 1 cut(s) 135
MboII GAAGA 5 cut(s) 79, 121, 124, 145, 241
MhlI GDGCHC 1 cut(s) 204
MnlI CCTC 1 cut(s) 228
MspA1I CMGCKG 2 cut(s) 25, 68
MvnI CGCG 1 cut(s) 122
NdeII GATC 1 cut(s) 135
NmuCI GTSAC 1 cut(s) 139
PkrI GCNGC 4 cut(s) 24, 27, 124, 164
PspFI CCCAGC 1 cut(s) 58
PvuII CAGCTG 1 cut(s) 68
SatI GCNGC 4 cut(s) 23, 26, 123, 163
Sau3AI GATC 1 cut(s) 135
SduI GDGCHC 1 cut(s) 204
SetI ASST 4 cut(s) 19, 51, 64, 70
SmlI CTYRAG 1 cut(s) 126
SmoI CTYRAG 1 cut(s) 126
SsiI CCGC 2 cut(s) 23, 122
TaaI ACNGT 2 cut(s) 82, 193
TaiI ACGT 1 cut(s) 51
TauI GCSGC 2 cut(s) 25, 125
TscAI CASTG 1 cut(s) 196
TseFI GTSAC 1 cut(s) 139
TseI GCWGC 2 cut(s) 25, 162
Tsp45I GTSAC 1 cut(s) 139
TspRI CASTG 1 cut(s) 196
XcmI CCANNNNNNNNNTGG 1 cut(s) 231
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.