FvH4_5g07230

RPM1-interacting protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb5
OG0005964
Physical Location & Seq
Reverse (-)
4221443 .. 4223039
1597 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_5g07230.t2

Sequence Viewer

Length: 252 bp
ATGGCTTCGCAGGATAAAGGTCGGCCCTTACCTAAGTTTGGTGAGTGGGATGTAAATAACCCAGCATCAGCTGAAGGATTTACTGTCATATTCAACCAGGCTCGAGATGATAAGAAGACCAATGCGTCTAATGCTACCCCACGAAAAACCGATAGTAGCGTACGAAGAGGAGGTACTAAATACAACAATGACTACCGCGTCGACAATTATCCTCAGTATCCCCAGAAGAAGAAGTGGTTTTGTTGTGGTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
AvrRpt-cleavage

Protein Analysis

84

Amino Acids

9.46

Weight (kDa)

9.55

Isoelectric Point (pI)

27.05

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
AvrRpt-cleavage PF05627 5 - 38 5.9e-19 Cleavage site for pathogenic type III effector avirulence factor Avr
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 2 cut(s) 124, 197
AccI GTMKAC 1 cut(s) 201
AccII CGCG 1 cut(s) 198
AciI CCGC 1 cut(s) 196
AcuI CTGAAG 1 cut(s) 93
AfaI GTAC 2 cut(s) 162, 175
AfiI CCNNNNNNNGG 1 cut(s) 38
AgsI TTSAA 1 cut(s) 94
AjnI CCWGG 1 cut(s) 96
AluBI AGCT 1 cut(s) 71
AluI AGCT 1 cut(s) 71
Ama87I CYCGRG 1 cut(s) 102
AoxI GGCC 1 cut(s) 23
AspS9I GGNCC 1 cut(s) 24
AsuHPI GGTGA 1 cut(s) 53
AvaI CYCGRG 1 cut(s) 102
BarI GAAGNNNNNNTAC 2 cut(s) 157, 189
BbsI GAAGAC 1 cut(s) 122
BciT130I CCWGG 1 cut(s) 98
BciVI GTATCC 1 cut(s) 228
BfuI GTATCC 1 cut(s) 228
Bme1390I CCNGG 1 cut(s) 98
BmeT110I CYCGRG 1 cut(s) 102
BmgT120I GGNCC 1 cut(s) 24
BmrFI CCNGG 1 cut(s) 98
BmsI GCATC 1 cut(s) 74
BpiI GAAGAC 1 cut(s) 122
Bsc4I CCNNNNNNNGG 1 cut(s) 38
BseBI CCWGG 1 cut(s) 98
BseGI GGATG 1 cut(s) 55
BseLI CCNNNNNNNGG 1 cut(s) 38
BseMII CTCAG 1 cut(s) 227
BseRI GAGGAG 1 cut(s) 183
BseYI CCCAGC 1 cut(s) 61
Bsh1236I CGCG 1 cut(s) 198
BshFI GGCC 1 cut(s) 25
BsiHKCI CYCGRG 1 cut(s) 102
BsiWI CGTACG 1 cut(s) 160
BslI CCNNNNNNNGG 1 cut(s) 38
BsnI GGCC 1 cut(s) 25
BsoBI CYCGRG 1 cut(s) 102
BspACI CCGC 1 cut(s) 196
BspANI GGCC 1 cut(s) 25
BspCNI CTCAG 1 cut(s) 226
BspFNI CGCG 1 cut(s) 198
Bst2UI CCWGG 1 cut(s) 98
Bst4CI ACNGT 1 cut(s) 85
Bst6I CTCTTC 1 cut(s) 160
BstDEI CTNAG 2 cut(s) 33, 213
BstF5I GGATG 1 cut(s) 55
BstFNI CGCG 1 cut(s) 198
BstMWI GCNNNNNNNGC 1 cut(s) 131
BstNI CCWGG 1 cut(s) 98
BstSCI CCNGG 1 cut(s) 96
BstUI CGCG 1 cut(s) 198
BstV2I GAAGAC 1 cut(s) 122
BsuI GTATCC 1 cut(s) 228
BsuRI GGCC 1 cut(s) 25
BtsCI GGATG 1 cut(s) 55
Cfr13I GGNCC 1 cut(s) 24
CseI GACGC 2 cut(s) 114, 187
Csp6I GTAC 2 cut(s) 161, 174
CviJI RGCY 4 cut(s) 5, 25, 71, 101
CviKI_1 RGCY 4 cut(s) 5, 25, 71, 101
CviQI GTAC 2 cut(s) 161, 174
DdeI CTNAG 2 cut(s) 33, 213
DrdI GACNNNNNNGTC 2 cut(s) 124, 197
DseDI GACNNNNNNGTC 2 cut(s) 124, 197
Eam1104I CTCTTC 1 cut(s) 160
EarI CTCTTC 1 cut(s) 160
Eco57I CTGAAG 1 cut(s) 93
Eco88I CYCGRG 1 cut(s) 102
EcoRII CCWGG 1 cut(s) 96
FaiI YATR 1 cut(s) 89
FblI GTMKAC 1 cut(s) 201
FokI GGATG 1 cut(s) 62
GsaI CCCAGC 1 cut(s) 65
HaeIII GGCC 1 cut(s) 25
HgaI GACGC 2 cut(s) 114, 187
HincII GTYRAC 1 cut(s) 202
HindII GTYRAC 1 cut(s) 202
HphI GGTGA 1 cut(s) 53
Hpy166II GTNNAC 1 cut(s) 202
Hpy188III TCNNGA 1 cut(s) 104
Hpy8I GTNNAC 1 cut(s) 202
Hpy99I CGWCG 1 cut(s) 203
HpyAV CCTTC 1 cut(s) 68
HpyCH4III ACNGT 1 cut(s) 85
HpyF10VI GCNNNNNNNGC 1 cut(s) 131
HpyF3I CTNAG 2 cut(s) 33, 213
LpnPI CCDG 4 cut(s) 75, 83, 110, 236
LweI GCATC 1 cut(s) 74
MboII GAAGA 4 cut(s) 127, 177, 238, 241
MluCI AATT 1 cut(s) 205
MnlI CCTC 3 cut(s) 161, 164, 222
MspA1I CMGCKG 1 cut(s) 71
MspR9I CCNGG 1 cut(s) 98
MvaI CCWGG 1 cut(s) 98
MvnI CGCG 1 cut(s) 198
MwoI GCNNNNNNNGC 1 cut(s) 131
PaeR7I CTCGAG 1 cut(s) 102
Pfl23II CGTACG 1 cut(s) 160
Psp6I CCWGG 1 cut(s) 96
PspFI CCCAGC 1 cut(s) 61
PspGI CCWGG 1 cut(s) 96
PspLI CGTACG 1 cut(s) 160
PspPI GGNCC 1 cut(s) 24
PvuII CAGCTG 1 cut(s) 71
RsaI GTAC 2 cut(s) 162, 175
RsaNI GTAC 2 cut(s) 161, 174
SalI GTCGAC 1 cut(s) 200
Sau96I GGNCC 1 cut(s) 24
ScrFI CCNGG 1 cut(s) 98
SetI ASST 4 cut(s) 22, 34, 73, 175
SfaNI GCATC 1 cut(s) 74
Sfr274I CTCGAG 1 cut(s) 102
SgeI CNNG 9 cut(s) 23, 74, 109, 110, 114, 116, 153, 209, 235
SlaI CTCGAG 1 cut(s) 102
SmlI CTYRAG 1 cut(s) 102
SmoI CTYRAG 1 cut(s) 102
Sse9I AATT 1 cut(s) 205
SsiI CCGC 1 cut(s) 196
StyD4I CCNGG 1 cut(s) 96
TaaI ACNGT 1 cut(s) 85
TaqI TCGA 2 cut(s) 103, 201
TasI AATT 1 cut(s) 205
XhoI CTCGAG 1 cut(s) 102
XmiI GTMKAC 1 cut(s) 201
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.