FvH4_6g52270

Cleavage site for pathogenic type III effector avirulence factor Avr

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb6
OG0005964
Physical Location & Seq
Reverse (-)
38548923 .. 38550077
1155 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_6g52270.t1

Sequence Viewer

Length: 219 bp
ATGGGATCGCAAGATGCAGGAAGACCTCTGCCGAAATTCGGAGAGTGGGATGTGAACAATCCAGCCTCGGCCGAAGGGTTTACAGTGATATTTAGCAAAGCTAGAGACCAGAAAATGAACAATGAAGCCGGAAACTCGACCATGCCTACACACAATAAGCCACAGCAGAACATTAACAATGATGATGAACCAAAGAAAAAGTGGTTTTGCTGTTTATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
AvrRpt-cleavage

Protein Analysis

73

Amino Acids

8.08

Weight (kDa)

6.54

Isoelectric Point (pI)

51.49

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
AvrRpt-cleavage PF05627 7 - 39 1e-18 Cleavage site for pathogenic type III effector avirulence factor Avr
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 13
AcoI YGGCCR 1 cut(s) 69
AcsI RAATTY 1 cut(s) 35
AfiI CCNNNNNNNGG 1 cut(s) 38
AluBI AGCT 1 cut(s) 101
AluI AGCT 1 cut(s) 101
Alw26I GTCTC 1 cut(s) 99
AlwI GGATC 1 cut(s) 13
AoxI GGCC 1 cut(s) 69
ApoI RAATTY 1 cut(s) 35
BbsI GAAGAC 1 cut(s) 28
BcoDI GTCTC 1 cut(s) 99
BfaI CTAG 1 cut(s) 102
BmsI GCATC 1 cut(s) 4
BpiI GAAGAC 1 cut(s) 28
BsaI GGTCTC 1 cut(s) 99
BsaJI CCNNGG 1 cut(s) 66
Bsc4I CCNNNNNNNGG 1 cut(s) 38
BseDI CCNNGG 1 cut(s) 66
BseGI GGATG 1 cut(s) 55
BseLI CCNNNNNNNGG 1 cut(s) 38
BseX3I CGGCCG 1 cut(s) 69
Bsh1285I CGRYCG 1 cut(s) 72
BshFI GGCC 1 cut(s) 71
BsiEI CGRYCG 1 cut(s) 72
BsiSI CCGG 1 cut(s) 129
BslI CCNNNNNNNGG 1 cut(s) 38
BsmAI GTCTC 1 cut(s) 99
BsnI GGCC 1 cut(s) 71
Bso31I GGTCTC 1 cut(s) 99
Bsp143I GATC 1 cut(s) 5
BspANI GGCC 1 cut(s) 71
BspPI GGATC 1 cut(s) 13
BspTNI GGTCTC 1 cut(s) 99
BssECI CCNNGG 1 cut(s) 66
BssMI GATC 1 cut(s) 5
Bst4CI ACNGT 1 cut(s) 85
BstF5I GGATG 1 cut(s) 55
BstKTI GATC 1 cut(s) 8
BstMAI GTCTC 1 cut(s) 99
BstMBI GATC 1 cut(s) 5
BstMCI CGRYCG 1 cut(s) 72
BstV2I GAAGAC 1 cut(s) 28
BstZI CGGCCG 1 cut(s) 69
BsuRI GGCC 1 cut(s) 71
BtsCI GGATG 1 cut(s) 55
BtsIMutI CAGTG 1 cut(s) 90
CviAII CATG 1 cut(s) 142
CviJI RGCY 5 cut(s) 65, 71, 101, 128, 160
CviKI_1 RGCY 5 cut(s) 65, 71, 101, 128, 160
DpnI GATC 1 cut(s) 7
DpnII GATC 1 cut(s) 5
EaeI YGGCCR 1 cut(s) 69
EagI CGGCCG 1 cut(s) 69
EclXI CGGCCG 1 cut(s) 69
Eco31I GGTCTC 1 cut(s) 99
Eco52I CGGCCG 1 cut(s) 69
FaeI CATG 1 cut(s) 145
FaiI YATR 2 cut(s) 143, 217
FatI CATG 1 cut(s) 141
FokI GGATG 1 cut(s) 62
FspBI CTAG 1 cut(s) 102
HaeIII GGCC 1 cut(s) 71
HapII CCGG 1 cut(s) 129
Hin1II CATG 1 cut(s) 145
HpaII CCGG 1 cut(s) 129
Hpy166II GTNNAC 2 cut(s) 55, 81
Hpy188I TCNGA 1 cut(s) 41
Hpy8I GTNNAC 2 cut(s) 55, 81
HpyAV CCTTC 1 cut(s) 68
HpyCH4III ACNGT 1 cut(s) 85
HpyCH4V TGCA 1 cut(s) 17
Hsp92II CATG 1 cut(s) 145
Kzo9I GATC 1 cut(s) 5
LpnPI CCDG 4 cut(s) 3, 75, 122, 142
LweI GCATC 1 cut(s) 4
MaeI CTAG 1 cut(s) 102
MalI GATC 1 cut(s) 7
MboI GATC 1 cut(s) 5
MboII GAAGA 1 cut(s) 33
MluCI AATT 1 cut(s) 35
MnlI CCTC 2 cut(s) 36, 76
MseI TTAA 1 cut(s) 174
MspI CCGG 1 cut(s) 129
NdeII GATC 1 cut(s) 5
NlaIII CATG 1 cut(s) 145
NmeAIII GCCGAG 1 cut(s) 47
SaqAI TTAA 1 cut(s) 174
Sau3AI GATC 1 cut(s) 5
SetI ASST 2 cut(s) 28, 103
SfaNI GCATC 1 cut(s) 4
SgeI CNNG 9 cut(s) 23, 30, 74, 79, 114, 121, 141, 148, 154
Sse9I AATT 1 cut(s) 35
SspMI CTAG 1 cut(s) 102
TaaI ACNGT 1 cut(s) 85
TaqI TCGA 1 cut(s) 137
TasI AATT 1 cut(s) 35
Tru1I TTAA 1 cut(s) 174
Tru9I TTAA 1 cut(s) 174
TscAI CASTG 1 cut(s) 90
TspDTI ATGAA 3 cut(s) 131, 138, 201
TspRI CASTG 1 cut(s) 90
XapI RAATTY 1 cut(s) 35
XcmI CCANNNNNNNNNTGG 1 cut(s) 198
XspI CTAG 1 cut(s) 102
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.