FvH4_4g32801

MLP-like protein

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb4
OG0017293
Physical Location & Seq
Forward (+)
31296943 .. 31297233
291 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_4g32801.t1

Sequence Viewer

Length: 291 bp
ATGTTTTGGTATGGAGATGGGAAAGCAAAAGTAGCCAAGGAGATAATCGAAGCCATAGACAAGGAGAACAATTTATTGACTTGGAAAGTGATCGGAGGAGACCTACTTGAGCATTACAAGAGCGTCAAGTTCATTCTGCAGGTTACTTCTCGAAGTGGTGATCAGGCCTCATCAGTGGTGCATTGGATTTTGGAATATGAAAAGGTGAATGACAATGTTCCAGATCCTCATGCTTTGCTCCAGCTGGTAATTGAAATCAACAAGGACATTGATGCTCATCTAAACACTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0009507 GO:0009536 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044424 GO:0044444 GO:0044464
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Bet_v_1

Protein Analysis

97

Amino Acids

10.93

Weight (kDa)

5.21

Isoelectric Point (pI)

39.52

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Bet_v_1 PF00407 5 - 95 6.9e-28 Pathogenesis-related protein Bet v 1 family
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0017293)

Species Orthologous Gene IDs
fragaria_vesca FvH4_4g32801
rosa_laevigata RLG00000034237
rosa_multiflora Rmu_sc0000483.1_g000027 Rmu_sc0000551.1_g000005
rosa_roxburghii Rroxscaffold_1G00012730 Rroxscaffold_3G00229660
rosa_samantha Rh1CG405100 Rh5AG343100 Rh6CG223000 Rh7AG416700 Rh7DG365500 Rh7DG410900
rosa_wichuraiana Rw7G034500

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
Acc36I ACCTGC 1 cut(s) 130
AclWI GGATC 1 cut(s) 218
AgsI TTSAA 1 cut(s) 254
AluBI AGCT 1 cut(s) 244
AluI AGCT 1 cut(s) 244
Alw26I GTCTC 1 cut(s) 93
AlwI GGATC 1 cut(s) 218
AoxI GGCC 1 cut(s) 165
AsuHPI GGTGA 2 cut(s) 170, 217
BccI CCATC 1 cut(s) 11
BclI TGATCA 1 cut(s) 160
BcoDI GTCTC 1 cut(s) 93
BfmI CTRYAG 1 cut(s) 137
BfuAI ACCTGC 1 cut(s) 130
BmsI GCATC 1 cut(s) 262
BpmI CTGGAG 1 cut(s) 224
BpuEI CTTGAG 1 cut(s) 128
BsaBI GATNNNNATC 1 cut(s) 276
BsaI GGTCTC 1 cut(s) 93
BsaJI CCNNGG 1 cut(s) 36
Bse8I GATNNNNATC 1 cut(s) 276
BseDI CCNNGG 1 cut(s) 36
BseJI GATNNNNATC 1 cut(s) 276
BseRI GAGGAG 1 cut(s) 111
BshFI GGCC 1 cut(s) 167
BsmAI GTCTC 1 cut(s) 93
BsnI GGCC 1 cut(s) 167
Bso31I GGTCTC 1 cut(s) 93
Bsp143I GATC 3 cut(s) 90, 160, 223
BspANI GGCC 1 cut(s) 167
BspMAI CTGCAG 1 cut(s) 141
BspMI ACCTGC 1 cut(s) 130
BspPI GGATC 1 cut(s) 218
BspTNI GGTCTC 1 cut(s) 93
BssECI CCNNGG 1 cut(s) 36
BssMI GATC 3 cut(s) 90, 160, 223
BssT1I CCWWGG 1 cut(s) 36
BstKTI GATC 3 cut(s) 93, 163, 226
BstMAI GTCTC 1 cut(s) 93
BstMBI GATC 3 cut(s) 90, 160, 223
BstMWI GCNNNNNNNGC 1 cut(s) 32
BstSFI CTRYAG 1 cut(s) 137
BstX2I RGATCY 1 cut(s) 223
BstYI RGATCY 1 cut(s) 223
BsuRI GGCC 1 cut(s) 167
BtsIMutI CAGTG 1 cut(s) 180
BveI ACCTGC 1 cut(s) 130
CseI GACGC 1 cut(s) 112
CviAII CATG 1 cut(s) 230
CviJI RGCY 4 cut(s) 35, 53, 167, 244
CviKI_1 RGCY 4 cut(s) 35, 53, 167, 244
DpnI GATC 3 cut(s) 92, 162, 225
DpnII GATC 3 cut(s) 90, 160, 223
Eco130I CCWWGG 1 cut(s) 36
Eco147I AGGCCT 1 cut(s) 167
Eco31I GGTCTC 1 cut(s) 93
EcoT14I CCWWGG 1 cut(s) 36
ErhI CCWWGG 1 cut(s) 36
FaeI CATG 1 cut(s) 233
FaiI YATR 4 cut(s) 12, 56, 198, 231
FatI CATG 1 cut(s) 229
FbaI TGATCA 1 cut(s) 160
GsuI CTGGAG 1 cut(s) 224
HaeIII GGCC 1 cut(s) 167
HgaI GACGC 1 cut(s) 112
Hin1II CATG 1 cut(s) 233
HphI GGTGA 2 cut(s) 170, 217
Hpy188I TCNGA 1 cut(s) 95
Hpy188III TCNNGA 2 cut(s) 150, 221
HpyCH4V TGCA 2 cut(s) 139, 181
HpyF10VI GCNNNNNNNGC 1 cut(s) 32
Hsp92II CATG 1 cut(s) 233
Ksp22I TGATCA 1 cut(s) 160
Kzo9I GATC 3 cut(s) 90, 160, 223
LmnI GCTCC 1 cut(s) 243
LpnPI CCDG 5 cut(s) 125, 149, 230, 234, 254
LweI GCATC 1 cut(s) 262
MaeIII GTNAC 1 cut(s) 142
MalI GATC 3 cut(s) 92, 162, 225
MboI GATC 3 cut(s) 90, 160, 223
MflI RGATCY 1 cut(s) 223
MluCI AATT 2 cut(s) 70, 249
MnlI CCTC 3 cut(s) 89, 178, 237
MseI TTAA 1 cut(s) 289
MspA1I CMGCKG 1 cut(s) 244
MwoI GCNNNNNNNGC 1 cut(s) 32
NdeII GATC 3 cut(s) 90, 160, 223
NlaIII CATG 1 cut(s) 233
PceI AGGCCT 1 cut(s) 167
PstI CTGCAG 1 cut(s) 141
PsuI RGATCY 1 cut(s) 223
PvuII CAGCTG 1 cut(s) 244
SaqAI TTAA 1 cut(s) 289
Sau3AI GATC 3 cut(s) 90, 160, 223
SetI ASST 4 cut(s) 105, 144, 207, 246
SfaNI GCATC 1 cut(s) 262
SfcI CTRYAG 1 cut(s) 137
SmlI CTYRAG 1 cut(s) 107
SmoI CTYRAG 1 cut(s) 107
Sse9I AATT 2 cut(s) 70, 249
SseBI AGGCCT 1 cut(s) 167
StuI AGGCCT 1 cut(s) 167
StyI CCWWGG 1 cut(s) 36
TaqI TCGA 2 cut(s) 48, 151
TasI AATT 2 cut(s) 70, 249
Tru1I TTAA 1 cut(s) 289
Tru9I TTAA 1 cut(s) 289
TscAI CASTG 1 cut(s) 180
TspDTI ATGAA 2 cut(s) 121, 213
TspRI CASTG 1 cut(s) 180
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.