Rh6CG223000

No description available

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr6C
Physical Location & Seq
Forward (+)
37184510 .. 37184665
156 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh6CG223000.1

Sequence Viewer

Length: 156 bp
ATGGCGGAGCCAGAAGAGATACTAGGGGCGTCGCTTATGGAGAAGATCTACTCCCACTGCCGCTCATCATCGTCATCTTCTAACAATGACAAGCCGTCGAAGAAGGCCGCTGCCATCAAGAAGGCCGATGATGTCAAGCACAAGGCTGCCATGTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

51

Amino Acids

5.49

Weight (kDa)

8.85

Isoelectric Point (pI)

58.9

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017293)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccBSI CCGCTC 1 cut(s) 63
AciI CCGC 3 cut(s) 5, 61, 108
AcyI GRCGYC 1 cut(s) 29
AhdI GACNNNNNGTC 1 cut(s) 94
AoxI GGCC 2 cut(s) 105, 123
ApeKI GCWGC 2 cut(s) 110, 146
BbvI GCAGC 2 cut(s) 97, 133
BccI CCATC 1 cut(s) 122
BceAI ACGGC 1 cut(s) 79
BfaI CTAG 1 cut(s) 23
BglII AGATCT 1 cut(s) 45
BisI GCNGC 4 cut(s) 61, 108, 111, 147
BlsI GCNGC 4 cut(s) 62, 109, 112, 148
BmeRI GACNNNNNGTC 1 cut(s) 94
BmiI GGNNCC 1 cut(s) 9
BsaHI GRCGYC 1 cut(s) 29
BseXI GCAGC 2 cut(s) 97, 133
BshFI GGCC 2 cut(s) 107, 125
BsnI GGCC 2 cut(s) 107, 125
Bsp143I GATC 1 cut(s) 45
BspACI CCGC 3 cut(s) 5, 61, 108
BspANI GGCC 2 cut(s) 107, 125
BspLI GGNNCC 1 cut(s) 9
BsrBI CCGCTC 1 cut(s) 63
BssMI GATC 1 cut(s) 45
BssNI GRCGYC 1 cut(s) 29
Bst6I CTCTTC 1 cut(s) 9
BstACI GRCGYC 1 cut(s) 29
BstKTI GATC 1 cut(s) 48
BstMBI GATC 1 cut(s) 45
BstV1I GCAGC 2 cut(s) 97, 133
BstX2I RGATCY 1 cut(s) 45
BstYI RGATCY 1 cut(s) 45
BsuRI GGCC 2 cut(s) 107, 125
BtsI GCAGTG 1 cut(s) 55
BtsIMutI CAGTG 1 cut(s) 55
CseI GACGC 1 cut(s) 18
CviAII CATG 1 cut(s) 151
CviJI RGCY 5 cut(s) 10, 94, 107, 125, 146
CviKI_1 RGCY 5 cut(s) 10, 94, 107, 125, 146
DpnI GATC 1 cut(s) 47
DpnII GATC 1 cut(s) 45
DriI GACNNNNNGTC 1 cut(s) 94
Eam1104I CTCTTC 1 cut(s) 9
Eam1105I GACNNNNNGTC 1 cut(s) 94
EarI CTCTTC 1 cut(s) 9
EciI GGCGGA 1 cut(s) 20
FaeI CATG 1 cut(s) 154
FaiI YATR 2 cut(s) 38, 152
FatI CATG 1 cut(s) 150
Fnu4HI GCNGC 4 cut(s) 61, 108, 111, 147
Fsp4HI GCNGC 4 cut(s) 61, 108, 111, 147
FspBI CTAG 1 cut(s) 23
GluI GCNGC 4 cut(s) 61, 108, 111, 147
HaeIII GGCC 2 cut(s) 107, 125
HgaI GACGC 1 cut(s) 18
Hin1I GRCGYC 1 cut(s) 29
Hin1II CATG 1 cut(s) 154
Hpy188III TCNNGA 1 cut(s) 118
Hpy99I CGWCG 2 cut(s) 34, 100
HpyAV CCTTC 2 cut(s) 97, 115
Hsp92I GRCGYC 1 cut(s) 29
Hsp92II CATG 1 cut(s) 154
Kzo9I GATC 1 cut(s) 45
LmnI GCTCC 1 cut(s) 7
LpnPI CCDG 1 cut(s) 24
Lsp1109I GCAGC 2 cut(s) 97, 133
MaeI CTAG 1 cut(s) 23
MalI GATC 1 cut(s) 47
MbiI CCGCTC 1 cut(s) 63
MboI GATC 1 cut(s) 45
MboII GAAGA 4 cut(s) 26, 55, 69, 112
MflI RGATCY 1 cut(s) 45
MspA1I CMGCKG 1 cut(s) 110
NdeII GATC 1 cut(s) 45
NlaIII CATG 1 cut(s) 154
NlaIV GGNNCC 1 cut(s) 9
PkrI GCNGC 4 cut(s) 62, 109, 112, 148
PspN4I GGNNCC 1 cut(s) 9
PsuI RGATCY 1 cut(s) 45
SatI GCNGC 4 cut(s) 61, 108, 111, 147
Sau3AI GATC 1 cut(s) 45
SgeI CNNG 5 cut(s) 23, 35, 103, 130, 148
SsiI CCGC 3 cut(s) 5, 61, 108
SspMI CTAG 1 cut(s) 23
TaqI TCGA 1 cut(s) 98
TauI GCSGC 2 cut(s) 63, 110
TscAI CASTG 1 cut(s) 62
TseI GCWGC 2 cut(s) 110, 146
TspRI CASTG 1 cut(s) 62
XspI CTAG 1 cut(s) 23
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.