FvH4_5g18511
NAC Family

Nascent polypeptide-associated complex subunit beta

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb5
OG0011463
Physical Location & Seq
Reverse (-)
10651984 .. 10654676
2693 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_5g18511.t2

Sequence Viewer

Length: 510 bp
ATGAATCGGGAGAAACTTATGAAGATGGCCGGTGCTGTTCGCACCGGTGGAAAGGGTAGCGTGAGGAGAAAGAAGAAGGCTGTCCATAAGACAACCACCACAGATGACAAAAGACTTCAGAGCACCCTTAAGAGAATAGGGGTGAATGCTATTCCAGCAATCGAGGAGGTCAACATCTTTAAGGATGATGTAGTTATTCAGTTCCTAAATCCTAAAGTTCAAGCTTCTATTGCTGCCAACACTTGGGTTGTTAGTGGTGCTCCTCAAACAAAGAAGTTGCAGGATATTCTACCTAGTATTATCAGCCATTTGGGGCCAGATAACTTGGACAACTTGAAGAAACTAGCAGAGCAGTTCCAAAAGCAAGCCCCTAATGCTGGTGCTGGTGGAGCCACTGCCCCAGAAGATGATGATGATGAGGTCCCAGAGCTTGTTGCTGGGGAGACCTTTGAAGCTGCTGCCGAGGAGAAGGATAATAAGGAGGATAAGGAGGAGAGTCAAGCTTCTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0006950 GO:0006970 GO:0008150 GO:0009628 GO:0009651 GO:0050896
KEGG Pathways
Metabolic & Signaling
ko04214 map04214
Pfam Domains
Protein Families
NAC

Protein Analysis

170

Amino Acids

18.3

Weight (kDa)

5.79

Isoelectric Point (pI)

50.39

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
NAC PF01849 36 - 91 1.3e-19 NAC domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 243
AcoI YGGCCR 1 cut(s) 27
AcuI CTGAAG 1 cut(s) 101
AfiI CCNNNNNNNGG 2 cut(s) 243, 377
AflII CTTAAG 1 cut(s) 128
AgeI ACCGGT 1 cut(s) 44
AgsI TTSAA 3 cut(s) 221, 337, 452
AluBI AGCT 4 cut(s) 224, 430, 455, 503
AluI AGCT 4 cut(s) 224, 430, 455, 503
Alw21I GWGCWC 2 cut(s) 125, 262
Alw26I GTCTC 1 cut(s) 437
AoxI GGCC 2 cut(s) 27, 314
ApeKI GCWGC 3 cut(s) 233, 455, 458
AsiGI ACCGGT 1 cut(s) 44
AspS9I GGNCC 2 cut(s) 314, 421
AsuHPI GGTGA 1 cut(s) 154
AvaII GGWCC 1 cut(s) 421
Bbv12I GWGCWC 2 cut(s) 125, 262
BbvI GCAGC 3 cut(s) 220, 442, 445
BccI CCATC 1 cut(s) 19
BcoDI GTCTC 1 cut(s) 437
BfaI CTAG 2 cut(s) 294, 344
BfrI CTTAAG 1 cut(s) 128
BisI GCNGC 3 cut(s) 234, 456, 459
BlsI GCNGC 3 cut(s) 235, 457, 460
Bme18I GGWCC 1 cut(s) 421
BmgT120I GGNCC 2 cut(s) 314, 421
BmiI GGNNCC 3 cut(s) 315, 391, 423
BsaI GGTCTC 1 cut(s) 437
BsaJI CCNNGG 1 cut(s) 462
BsaWI WCCGGW 1 cut(s) 44
Bsc4I CCNNNNNNNGG 2 cut(s) 243, 377
Bse118I RCCGGY 2 cut(s) 29, 44
BseDI CCNNGG 1 cut(s) 462
BseGI GGATG 1 cut(s) 190
BseLI CCNNNNNNNGG 2 cut(s) 243, 377
BseRI GAGGAG 5 cut(s) 79, 179, 252, 479, 506
BseXI GCAGC 3 cut(s) 220, 442, 445
BseYI CCCAGC 1 cut(s) 437
BshFI GGCC 2 cut(s) 29, 316
BshTI ACCGGT 1 cut(s) 44
BsiHKAI GWGCWC 2 cut(s) 125, 262
BsiSI CCGG 2 cut(s) 30, 45
BslFI GGGAC 1 cut(s) 407
BslI CCNNNNNNNGG 2 cut(s) 243, 377
BsmAI GTCTC 1 cut(s) 437
BsmFI GGGAC 1 cut(s) 407
BsmI GAATGC 1 cut(s) 151
BsnI GGCC 2 cut(s) 29, 316
Bso31I GGTCTC 1 cut(s) 437
Bsp1286I GDGCHC 2 cut(s) 125, 262
BspANI GGCC 2 cut(s) 29, 316
BspLI GGNNCC 3 cut(s) 315, 391, 423
BspTI CTTAAG 1 cut(s) 128
BspTNI GGTCTC 1 cut(s) 437
BsrFI RCCGGY 2 cut(s) 29, 44
BssAI RCCGGY 2 cut(s) 29, 44
BssECI CCNNGG 1 cut(s) 462
BstAFI CTTAAG 1 cut(s) 128
BstC8I GCNNGC 1 cut(s) 366
BstDEI CTNAG 1 cut(s) 507
BstF5I GGATG 1 cut(s) 190
BstMAI GTCTC 1 cut(s) 437
BstMWI GCNNNNNNNGC 4 cut(s) 155, 230, 374, 389
BstV1I GCAGC 3 cut(s) 220, 442, 445
BsuRI GGCC 2 cut(s) 29, 316
BtsCI GGATG 1 cut(s) 190
BtsI GCAGTG 1 cut(s) 393
BtsIMutI CAGTG 1 cut(s) 393
Cac8I GCNNGC 1 cut(s) 366
Cfr10I RCCGGY 2 cut(s) 29, 44
Cfr13I GGNCC 2 cut(s) 314, 421
CspAI ACCGGT 1 cut(s) 44
DdeI CTNAG 1 cut(s) 507
EaeI YGGCCR 1 cut(s) 27
Eco31I GGTCTC 1 cut(s) 437
Eco47I GGWCC 1 cut(s) 421
Eco57I CTGAAG 1 cut(s) 101
EcoO109I RGGNCCY 1 cut(s) 421
FaiI YATR 2 cut(s) 20, 87
FaqI GGGAC 1 cut(s) 407
Fnu4HI GCNGC 3 cut(s) 234, 456, 459
FokI GGATG 1 cut(s) 197
Fsp4HI GCNGC 3 cut(s) 234, 456, 459
FspBI CTAG 2 cut(s) 294, 344
GluI GCNGC 3 cut(s) 234, 456, 459
GsaI CCCAGC 1 cut(s) 441
HaeIII GGCC 2 cut(s) 29, 316
HapII CCGG 2 cut(s) 30, 45
HincII GTYRAC 1 cut(s) 172
HindII GTYRAC 1 cut(s) 172
HindIII AAGCTT 2 cut(s) 222, 501
HinfI GANTC 2 cut(s) 4, 496
HpaII CCGG 2 cut(s) 30, 45
HphI GGTGA 1 cut(s) 154
Hpy166II GTNNAC 1 cut(s) 172
Hpy188I TCNGA 1 cut(s) 120
Hpy188III TCNNGA 1 cut(s) 8
Hpy8I GTNNAC 1 cut(s) 172
HpyAV CCTTC 2 cut(s) 70, 463
HpyCH4V TGCA 1 cut(s) 280
HpyF10VI GCNNNNNNNGC 4 cut(s) 155, 230, 374, 389
HpyF3I CTNAG 1 cut(s) 507
LmnI GCTCC 2 cut(s) 265, 389
Lsp1109I GCAGC 3 cut(s) 220, 442, 445
MaeI CTAG 2 cut(s) 294, 344
MboII GAAGA 4 cut(s) 34, 85, 349, 416
MhlI GDGCHC 2 cut(s) 125, 262
MlyI GAGTC 1 cut(s) 505
MnlI CCTC 8 cut(s) 57, 157, 160, 273, 412, 457, 475, 484
MseI TTAA 2 cut(s) 129, 180
MspCI CTTAAG 1 cut(s) 128
MspI CCGG 2 cut(s) 30, 45
Mva1269I GAATGC 1 cut(s) 151
MwoI GCNNNNNNNGC 4 cut(s) 155, 230, 374, 389
NlaIV GGNNCC 3 cut(s) 315, 391, 423
NmeAIII GCCGAG 1 cut(s) 487
PctI GAATGC 1 cut(s) 151
PfeI GAWTC 1 cut(s) 4
PflMI CCANNNNNTGG 1 cut(s) 243
PinAI ACCGGT 1 cut(s) 44
PkrI GCNGC 3 cut(s) 235, 457, 460
PleI GAGTC 1 cut(s) 504
PpsI GAGTC 1 cut(s) 504
PpuMI RGGWCCY 1 cut(s) 421
Psp5II RGGWCCY 1 cut(s) 421
PspFI CCCAGC 1 cut(s) 437
PspN4I GGNNCC 3 cut(s) 315, 391, 423
PspPI GGNCC 2 cut(s) 314, 421
PspPPI RGGWCCY 1 cut(s) 421
SaqAI TTAA 2 cut(s) 129, 180
SatI GCNGC 3 cut(s) 234, 456, 459
Sau96I GGNCC 2 cut(s) 314, 421
SchI GAGTC 1 cut(s) 505
SduI GDGCHC 2 cut(s) 125, 262
SetI ASST 8 cut(s) 171, 226, 295, 423, 432, 449, 457, 505
SgrAI CRCCGGYG 1 cut(s) 44
SinI GGWCC 1 cut(s) 421
SmlI CTYRAG 1 cut(s) 128
SmoI CTYRAG 1 cut(s) 128
SspMI CTAG 2 cut(s) 294, 344
TaqI TCGA 1 cut(s) 162
TfiI GAWTC 1 cut(s) 4
Tru1I TTAA 2 cut(s) 129, 180
Tru9I TTAA 2 cut(s) 129, 180
TscAI CASTG 1 cut(s) 400
TseI GCWGC 3 cut(s) 233, 455, 458
TspDTI ATGAA 2 cut(s) 17, 35
TspRI CASTG 1 cut(s) 400
Van91I CCANNNNNTGG 1 cut(s) 243
Vha464I CTTAAG 1 cut(s) 128
VpaK11BI GGWCC 1 cut(s) 421
XspI CTAG 2 cut(s) 294, 344
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.