FvH4_5g30991

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb5
OG0017674
Physical Location & Seq
Forward (+)
21945044 .. 21946167
1124 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_5g30991.t1

Sequence Viewer

Length: 426 bp
ATGAGTATTCTTCACTTGGGTTCTAGATCTGGTGCACATGAGATGAGGATGATGATGATTGTATCTGATACCGACGAAAAACTTTTTGAGATATCAAGCATCTCAAACATTTACTGTACGACAACCGGCGTTGTTACTCCTTGGGATAACATGTATCTCTATGTCAAAAGAGTGGTCGCCAGAGAAGAGCGAATAATTCAAAAGTCAACTACGATCGAATTTGTGAAGCAAATGATCGAAGAGCATTGCCATAGACGTGCAAAAGATAAATTGAAGCGTGATGACTACGACGACATCCTTGTTAGATGGCCATCTAGAGGGATTGGTCAAATGTATGCATTCACAGTTATTAATAACAATTCTCACTACTTTACCGAAATCAGAGTTGGAGATGACAGCAATTACGTTACATTAGGGAGTGGTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

142

Amino Acids

16.4

Weight (kDa)

6.51

Isoelectric Point (pI)

61.69

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0017674)

Species Orthologous Gene IDs
fragaria_vesca FvH4_5g30991 FvH4_5g31000
rosa_chinensis RchiOBHm_Chr2g0091881
rosa_laevigata RLG00000011651
rosa_roxburghii Rroxscaffold_2G00149640
rosa_rugosa Rorug02G0021500
rosa_samantha Rh2AG066900 Rh2BG065900 Rh2CG067300 Rh2DG066000 Rh6DG378500
rosa_wichuraiana Rw2G005390

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 308
AcsI RAATTY 1 cut(s) 218
AfaI GTAC 1 cut(s) 118
AfiI CCNNNNNNNGG 1 cut(s) 317
AflIII ACRYGT 1 cut(s) 150
AgsI TTSAA 2 cut(s) 200, 274
AjiI CACGTC 1 cut(s) 257
AjuI GAANNNNNNNTTGG 2 cut(s) 369, 401
Alw21I GWGCWC 1 cut(s) 37
Alw44I GTGCAC 1 cut(s) 33
AoxI GGCC 1 cut(s) 308
ApaLI GTGCAC 1 cut(s) 33
ApoI RAATTY 1 cut(s) 218
ArsI GACNNNNNNTTYG 2 cut(s) 159, 191
AseI ATTAAT 1 cut(s) 351
BaeGI GKGCMC 1 cut(s) 37
BalI TGGCCA 1 cut(s) 310
Bbv12I GWGCWC 1 cut(s) 37
BccI CCATC 2 cut(s) 300, 319
BfaI CTAG 2 cut(s) 24, 315
BglII AGATCT 1 cut(s) 26
BmgBI CACGTC 1 cut(s) 257
BmsI GCATC 1 cut(s) 108
BsaBI GATNNNNATC 1 cut(s) 310
BsaJI CCNNGG 1 cut(s) 140
Bsc4I CCNNNNNNNGG 1 cut(s) 317
Bse118I RCCGGY 1 cut(s) 125
Bse3DI GCAATG 1 cut(s) 244
Bse8I GATNNNNATC 1 cut(s) 310
BseDI CCNNGG 1 cut(s) 140
BseGI GGATG 2 cut(s) 54, 294
BseJI GATNNNNATC 1 cut(s) 310
BseLI CCNNNNNNNGG 1 cut(s) 317
BseMI GCAATG 1 cut(s) 244
BseSI GKGCMC 1 cut(s) 37
Bsh1285I CGRYCG 1 cut(s) 216
BshFI GGCC 1 cut(s) 310
BsiEI CGRYCG 1 cut(s) 216
BsiHKAI GWGCWC 1 cut(s) 37
BsiSI CCGG 1 cut(s) 126
BslI CCNNNNNNNGG 1 cut(s) 317
BsmI GAATGC 1 cut(s) 338
BsnI GGCC 1 cut(s) 310
Bsp1286I GDGCHC 1 cut(s) 37
Bsp143I GATC 3 cut(s) 26, 213, 234
BspANI GGCC 1 cut(s) 310
BspQI GCTCTTC 2 cut(s) 180, 234
BsrDI GCAATG 1 cut(s) 244
BsrFI RCCGGY 1 cut(s) 125
BssAI RCCGGY 1 cut(s) 125
BssECI CCNNGG 1 cut(s) 140
BssMI GATC 3 cut(s) 26, 213, 234
BssT1I CCWWGG 1 cut(s) 140
Bst4CI ACNGT 2 cut(s) 116, 346
Bst6I CTCTTC 2 cut(s) 180, 234
BstF5I GGATG 2 cut(s) 54, 294
BstKTI GATC 3 cut(s) 29, 216, 237
BstMBI GATC 3 cut(s) 26, 213, 234
BstMCI CGRYCG 1 cut(s) 216
BstNSI RCATGY 1 cut(s) 154
BstSLI GKGCMC 1 cut(s) 37
BstX2I RGATCY 1 cut(s) 26
BstYI RGATCY 1 cut(s) 26
BsuRI GGCC 1 cut(s) 310
BtrI CACGTC 1 cut(s) 257
BtsCI GGATG 2 cut(s) 54, 294
Cfr10I RCCGGY 1 cut(s) 125
Csp6I GTAC 1 cut(s) 117
CviAII CATG 2 cut(s) 38, 151
CviJI RGCY 1 cut(s) 310
CviKI_1 RGCY 1 cut(s) 310
CviQI GTAC 1 cut(s) 117
DpnI GATC 3 cut(s) 28, 215, 236
DpnII GATC 3 cut(s) 26, 213, 234
EaeI YGGCCR 1 cut(s) 308
Eam1104I CTCTTC 2 cut(s) 180, 234
EarI CTCTTC 2 cut(s) 180, 234
Eco130I CCWWGG 1 cut(s) 140
Eco32I GATATC 1 cut(s) 93
EcoRV GATATC 1 cut(s) 93
EcoT14I CCWWGG 1 cut(s) 140
EcoT22I ATGCAT 1 cut(s) 340
ErhI CCWWGG 1 cut(s) 140
FaeI CATG 2 cut(s) 41, 154
FaiI YATR 5 cut(s) 39, 152, 162, 252, 336
FatI CATG 2 cut(s) 37, 150
FokI GGATG 2 cut(s) 61, 281
FspBI CTAG 2 cut(s) 24, 315
HaeIII GGCC 1 cut(s) 310
HapII CCGG 1 cut(s) 126
Hin1II CATG 2 cut(s) 41, 154
HincII GTYRAC 1 cut(s) 207
HindII GTYRAC 1 cut(s) 207
HpaII CCGG 1 cut(s) 126
Hpy166II GTNNAC 2 cut(s) 35, 207
Hpy188I TCNGA 2 cut(s) 67, 383
Hpy188III TCNNGA 2 cut(s) 24, 315
Hpy8I GTNNAC 2 cut(s) 35, 207
Hpy99I CGWCG 2 cut(s) 77, 293
HpyCH4III ACNGT 2 cut(s) 116, 346
HpyCH4IV ACGT 2 cut(s) 256, 405
HpyCH4V TGCA 3 cut(s) 35, 260, 338
HpySE526I ACGT 2 cut(s) 256, 405
Hsp92II CATG 2 cut(s) 41, 154
Kzo9I GATC 3 cut(s) 26, 213, 234
LguI GCTCTTC 2 cut(s) 180, 234
LpnPI CCDG 3 cut(s) 15, 139, 193
LweI GCATC 1 cut(s) 108
MaeI CTAG 2 cut(s) 24, 315
MaeII ACGT 2 cut(s) 256, 405
MaeIII GTNAC 2 cut(s) 133, 406
MalI GATC 3 cut(s) 28, 215, 236
MboI GATC 3 cut(s) 26, 213, 234
MboII GAAGA 2 cut(s) 197, 251
MflI RGATCY 1 cut(s) 26
MhlI GDGCHC 1 cut(s) 37
MlsI TGGCCA 1 cut(s) 310
MluCI AATT 5 cut(s) 195, 218, 269, 358, 400
MluNI TGGCCA 1 cut(s) 310
MmeI TCCRAC 1 cut(s) 367
MnlI CCTC 2 cut(s) 39, 311
Mox20I TGGCCA 1 cut(s) 310
Mph1103I ATGCAT 1 cut(s) 340
MscI TGGCCA 1 cut(s) 310
MseI TTAA 2 cut(s) 351, 424
MslI CAYNNNNRTG 1 cut(s) 255
Msp20I TGGCCA 1 cut(s) 310
MspI CCGG 1 cut(s) 126
Mva1269I GAATGC 1 cut(s) 338
NdeII GATC 3 cut(s) 26, 213, 234
NlaIII CATG 2 cut(s) 41, 154
NsiI ATGCAT 1 cut(s) 340
NspI RCATGY 1 cut(s) 154
PciI ACATGT 1 cut(s) 150
PciSI GCTCTTC 2 cut(s) 180, 234
PctI GAATGC 1 cut(s) 338
Ple19I CGATCG 1 cut(s) 216
PscI ACATGT 1 cut(s) 150
PshBI ATTAAT 1 cut(s) 351
PsuI RGATCY 1 cut(s) 26
PvuI CGATCG 1 cut(s) 216
RsaI GTAC 1 cut(s) 118
RsaNI GTAC 1 cut(s) 117
RseI CAYNNNNRTG 1 cut(s) 255
SapI GCTCTTC 2 cut(s) 180, 234
SaqAI TTAA 2 cut(s) 351, 424
Sau3AI GATC 3 cut(s) 26, 213, 234
SduI GDGCHC 1 cut(s) 37
SetI ASST 2 cut(s) 259, 408
SfaNI GCATC 1 cut(s) 108
SmiMI CAYNNNNRTG 1 cut(s) 255
Sse9I AATT 5 cut(s) 195, 218, 269, 358, 400
SspMI CTAG 2 cut(s) 24, 315
StyI CCWWGG 1 cut(s) 140
TaaI ACNGT 2 cut(s) 116, 346
TaiI ACGT 2 cut(s) 259, 408
TaqI TCGA 2 cut(s) 216, 237
TasI AATT 5 cut(s) 195, 218, 269, 358, 400
Tru1I TTAA 2 cut(s) 351, 424
Tru9I TTAA 2 cut(s) 351, 424
VneI GTGCAC 1 cut(s) 33
VspI ATTAAT 1 cut(s) 351
XapI RAATTY 1 cut(s) 218
XbaI TCTAGA 2 cut(s) 23, 314
XceI RCATGY 1 cut(s) 154
XspI CTAG 2 cut(s) 24, 315
Zsp2I ATGCAT 1 cut(s) 340
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.