FvH4_5g31000

No description available

Basic Information

Type: gene
Biological Identity
fragaria_vesca
Fvb5
Physical Location & Seq
Forward (+)
21946255 .. 21946804
550 bp
Loading structure...
UTR
Exon/CDS
Intron
FvH4_5g31000.t1

Sequence Viewer

Length: 198 bp
ATGATCGGTCCTAATATAGGAGGAGGAGCACAGGCTGGTTGCCTAGAGGAGGGGGTTTATACACCAATTTTCTCAGGCGATGCCCTAAGTTTATACTCTCATTGTGTGGAGGCTGATGAAGAAGTCGTTATGATTCTATTTGTGCCAAATAACACTCTAACTGAATCACAGATAAAGCTTGGAGGAACTAAAAAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

66

Amino Acids

6.81

Weight (kDa)

4.38

Isoelectric Point (pI)

38.65

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0017674)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AfiI CCNNNNNNNGG 2 cut(s) 17, 49
AluBI AGCT 1 cut(s) 178
AluI AGCT 1 cut(s) 178
Alw21I GWGCWC 1 cut(s) 31
AspS9I GGNCC 1 cut(s) 8
AvaII GGWCC 1 cut(s) 8
Bbv12I GWGCWC 1 cut(s) 31
BfaI CTAG 1 cut(s) 44
Bme18I GGWCC 1 cut(s) 8
BmgT120I GGNCC 1 cut(s) 8
BmsI GCATC 1 cut(s) 70
Bsc4I CCNNNNNNNGG 2 cut(s) 17, 49
BseLI CCNNNNNNNGG 2 cut(s) 17, 49
BseMII CTCAG 1 cut(s) 87
BseRI GAGGAG 3 cut(s) 36, 39, 62
BsiHKAI GWGCWC 1 cut(s) 31
BslI CCNNNNNNNGG 2 cut(s) 17, 49
Bsp1286I GDGCHC 1 cut(s) 31
Bsp143I GATC 1 cut(s) 3
BspCNI CTCAG 1 cut(s) 86
BssMI GATC 1 cut(s) 3
BstDEI CTNAG 2 cut(s) 73, 86
BstENI CCTNNNNNAGG 2 cut(s) 15, 47
BstKTI GATC 1 cut(s) 6
BstMBI GATC 1 cut(s) 3
BtgZI GCGATG 1 cut(s) 93
Cfr13I GGNCC 1 cut(s) 8
CviJI RGCY 3 cut(s) 35, 113, 178
CviKI_1 RGCY 3 cut(s) 35, 113, 178
DdeI CTNAG 2 cut(s) 73, 86
DpnI GATC 1 cut(s) 5
DpnII GATC 1 cut(s) 3
Eco47I GGWCC 1 cut(s) 8
EcoNI CCTNNNNNAGG 2 cut(s) 15, 47
FaiI YATR 4 cut(s) 17, 60, 94, 131
FspBI CTAG 1 cut(s) 44
HindIII AAGCTT 1 cut(s) 176
HinfI GANTC 2 cut(s) 133, 164
HpyF3I CTNAG 2 cut(s) 73, 86
Kzo9I GATC 1 cut(s) 3
LmnI GCTCC 1 cut(s) 26
LpnPI CCDG 3 cut(s) 17, 21, 60
LweI GCATC 1 cut(s) 70
MaeI CTAG 1 cut(s) 44
MalI GATC 1 cut(s) 5
MboI GATC 1 cut(s) 3
MboII GAAGA 1 cut(s) 131
MhlI GDGCHC 1 cut(s) 31
MluCI AATT 1 cut(s) 66
MnlI CCTC 6 cut(s) 14, 17, 40, 43, 103, 176
NdeII GATC 1 cut(s) 3
PfeI GAWTC 2 cut(s) 133, 164
PspPI GGNCC 1 cut(s) 8
Sau3AI GATC 1 cut(s) 3
Sau96I GGNCC 1 cut(s) 8
SduI GDGCHC 1 cut(s) 31
SetI ASST 1 cut(s) 180
SfaNI GCATC 1 cut(s) 70
SgeI CNNG 5 cut(s) 44, 48, 56, 87, 191
SinI GGWCC 1 cut(s) 8
Sse9I AATT 1 cut(s) 66
SspMI CTAG 1 cut(s) 44
TasI AATT 1 cut(s) 66
TfiI GAWTC 2 cut(s) 133, 164
TspDTI ATGAA 1 cut(s) 132
VpaK11BI GGWCC 1 cut(s) 8
XagI CCTNNNNNAGG 2 cut(s) 15, 47
XspI CTAG 1 cut(s) 44
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.