MD00G1026900.v1.1

Uncharacterized conserved protein (DUF2358)

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr00
OG0008099
Physical Location & Seq
Reverse (-)
4513547 .. 4513879
333 bp
Loading structure...
UTR
Exon/CDS
Intron
MD00G1026900.v1.1.491

Sequence Viewer

Length: 333 bp
ATGATCAGCAAAAAACTTTCAGATCAAATCTTCCGGCCATTAATCCCCGCCGCGTGTGTCAGTTTCCGGCGGCTGAGCACCACTAAGTCCAAACTACTGCCCTGCCCACGCCCTGAACCTTTGAAACTCAAACACTTAGCCCAAAACTCCAAATGGGCTGTTAGGCTAAGCTTAGTGGACCAAAGCCCACCAAAATCAACGTTTGACGTGGAACGGTTAGTAGGGCTTTCGTACGAGGATATGGTTCATCTTTTTGATGATCAGGGAATTGATCGGACGGCGTATGATGAGCGTCTGAAGTTCAGGGACCCAATCAATAAGCATGCGCTATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
DUF2358 SOUL

Protein Analysis

111

Amino Acids

12.67

Weight (kDa)

9.59

Isoelectric Point (pI)

37.76

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 53
AciI CCGC 3 cut(s) 48, 51, 70
AclI AACGTT 1 cut(s) 200
AcoI YGGCCR 1 cut(s) 35
AcuI CTGAAG 1 cut(s) 317
AfaI GTAC 1 cut(s) 233
AgsI TTSAA 1 cut(s) 124
AjiI CACGTC 1 cut(s) 208
AluBI AGCT 1 cut(s) 171
AluI AGCT 1 cut(s) 171
Alw21I GWGCWC 1 cut(s) 80
AoxI GGCC 1 cut(s) 35
AseI ATTAAT 1 cut(s) 41
AspLEI GCGC 1 cut(s) 328
AspS9I GGNCC 2 cut(s) 178, 307
AvaII GGWCC 2 cut(s) 178, 307
Bbv12I GWGCWC 1 cut(s) 80
BceAI ACGGC 1 cut(s) 294
BclI TGATCA 2 cut(s) 3, 259
BisI GCNGC 2 cut(s) 51, 71
BlpI GCTNAGC 2 cut(s) 74, 167
BlsI GCNGC 2 cut(s) 52, 72
Bme18I GGWCC 2 cut(s) 178, 307
BmgBI CACGTC 1 cut(s) 208
BmgT120I GGNCC 2 cut(s) 178, 307
BmiI GGNNCC 2 cut(s) 308, 309
Bpu1102I GCTNAGC 2 cut(s) 74, 167
BseMII CTCAG 1 cut(s) 65
Bsh1236I CGCG 1 cut(s) 53
BshFI GGCC 1 cut(s) 37
BsiHKAI GWGCWC 1 cut(s) 80
BsiSI CCGG 2 cut(s) 34, 67
BsiWI CGTACG 1 cut(s) 231
BslFI GGGAC 1 cut(s) 320
BsmFI GGGAC 1 cut(s) 320
BsnI GGCC 1 cut(s) 37
Bsp1286I GDGCHC 1 cut(s) 80
Bsp143I GATC 4 cut(s) 3, 22, 259, 271
Bsp1720I GCTNAGC 2 cut(s) 74, 167
BspACI CCGC 3 cut(s) 48, 51, 70
BspANI GGCC 1 cut(s) 37
BspCNI CTCAG 1 cut(s) 66
BspFNI CGCG 1 cut(s) 53
BspLI GGNNCC 2 cut(s) 308, 309
BssMI GATC 4 cut(s) 3, 22, 259, 271
Bst4CI ACNGT 1 cut(s) 216
BstC8I GCNNGC 1 cut(s) 324
BstDEI CTNAG 5 cut(s) 74, 84, 136, 167, 172
BstFNI CGCG 1 cut(s) 53
BstHHI GCGC 1 cut(s) 328
BstKTI GATC 4 cut(s) 6, 25, 262, 274
BstMBI GATC 4 cut(s) 3, 22, 259, 271
BstNSI RCATGY 1 cut(s) 326
BstUI CGCG 1 cut(s) 53
BsuRI GGCC 1 cut(s) 37
BtrI CACGTC 1 cut(s) 208
Cac8I GCNNGC 1 cut(s) 324
CfoI GCGC 1 cut(s) 328
Cfr13I GGNCC 2 cut(s) 178, 307
CseI GACGC 1 cut(s) 281
Csp6I GTAC 1 cut(s) 232
CviAII CATG 1 cut(s) 323
CviJI RGCY 8 cut(s) 37, 73, 140, 158, 166, 171, 186, 226
CviKI_1 RGCY 8 cut(s) 37, 73, 140, 158, 166, 171, 186, 226
CviQI GTAC 1 cut(s) 232
DdeI CTNAG 5 cut(s) 74, 84, 136, 167, 172
DpnI GATC 4 cut(s) 5, 24, 261, 273
DpnII GATC 4 cut(s) 3, 22, 259, 271
EaeI YGGCCR 1 cut(s) 35
Eco47I GGWCC 2 cut(s) 178, 307
Eco57I CTGAAG 1 cut(s) 317
EcoO109I RGGNCCY 1 cut(s) 307
FaeI CATG 1 cut(s) 326
FaiI YATR 4 cut(s) 242, 285, 324, 331
FaqI GGGAC 1 cut(s) 320
FatI CATG 1 cut(s) 322
FauI CCCGC 1 cut(s) 55
FbaI TGATCA 2 cut(s) 3, 259
Fnu4HI GCNGC 2 cut(s) 51, 71
Fsp4HI GCNGC 2 cut(s) 51, 71
GlaI GCGC 1 cut(s) 327
GluI GCNGC 2 cut(s) 51, 71
HaeIII GGCC 1 cut(s) 37
HapII CCGG 2 cut(s) 34, 67
HgaI GACGC 1 cut(s) 281
HhaI GCGC 1 cut(s) 328
Hin1II CATG 1 cut(s) 326
Hin6I GCGC 1 cut(s) 326
HinP1I GCGC 1 cut(s) 326
HindIII AAGCTT 1 cut(s) 169
HpaII CCGG 2 cut(s) 34, 67
Hpy166II GTNNAC 1 cut(s) 178
Hpy188I TCNGA 3 cut(s) 22, 276, 297
Hpy8I GTNNAC 1 cut(s) 178
HpyCH4III ACNGT 1 cut(s) 216
HpyCH4IV ACGT 2 cut(s) 200, 207
HpyF3I CTNAG 5 cut(s) 74, 84, 136, 167, 172
HpySE526I ACGT 2 cut(s) 200, 207
Hsp92II CATG 1 cut(s) 326
HspAI GCGC 1 cut(s) 326
KflI GGGWCCC 1 cut(s) 307
Ksp22I TGATCA 2 cut(s) 3, 259
Kzo9I GATC 4 cut(s) 3, 22, 259, 271
LpnPI CCDG 6 cut(s) 47, 80, 115, 126, 248, 289
MaeII ACGT 2 cut(s) 200, 207
MalI GATC 4 cut(s) 5, 24, 261, 273
MboI GATC 4 cut(s) 3, 22, 259, 271
MboII GAAGA 1 cut(s) 22
MhlI GDGCHC 1 cut(s) 80
MluCI AATT 1 cut(s) 267
MnlI CCTC 1 cut(s) 229
MseI TTAA 1 cut(s) 41
MspI CCGG 2 cut(s) 34, 67
MvnI CGCG 1 cut(s) 53
NdeII GATC 4 cut(s) 3, 22, 259, 271
NlaIII CATG 1 cut(s) 326
NlaIV GGNNCC 2 cut(s) 308, 309
NspI RCATGY 1 cut(s) 326
PaeI GCATGC 1 cut(s) 326
Pfl23II CGTACG 1 cut(s) 231
PkrI GCNGC 2 cut(s) 52, 72
PpuMI RGGWCCY 1 cut(s) 307
PshBI ATTAAT 1 cut(s) 41
Psp1406I AACGTT 1 cut(s) 200
Psp5II RGGWCCY 1 cut(s) 307
PspLI CGTACG 1 cut(s) 231
PspN4I GGNNCC 2 cut(s) 308, 309
PspPI GGNCC 2 cut(s) 178, 307
PspPPI RGGWCCY 1 cut(s) 307
RsaI GTAC 1 cut(s) 233
RsaNI GTAC 1 cut(s) 232
SaqAI TTAA 1 cut(s) 41
SatI GCNGC 2 cut(s) 51, 71
Sau3AI GATC 4 cut(s) 3, 22, 259, 271
Sau96I GGNCC 2 cut(s) 178, 307
SduI GDGCHC 1 cut(s) 80
SetI ASST 4 cut(s) 121, 173, 203, 210
SinI GGWCC 2 cut(s) 178, 307
SphI GCATGC 1 cut(s) 326
Sse9I AATT 1 cut(s) 267
SsiI CCGC 3 cut(s) 48, 51, 70
TaaI ACNGT 1 cut(s) 216
TaiI ACGT 2 cut(s) 203, 210
TasI AATT 1 cut(s) 267
TauI GCSGC 2 cut(s) 53, 73
Tru1I TTAA 1 cut(s) 41
Tru9I TTAA 1 cut(s) 41
TspDTI ATGAA 1 cut(s) 236
VpaK11BI GGWCC 2 cut(s) 178, 307
VspI ATTAAT 1 cut(s) 41
XceI RCATGY 1 cut(s) 326
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.