MD00G1157500.v1.1

No description available

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr00
Physical Location & Seq
Forward (+)
34809583 .. 34811670
2088 bp
Loading structure...
UTR
Exon/CDS
Intron
MD00G1157500.v1.1.491

Sequence Viewer

Length: 144 bp
ATGGCTAAGGGAGGCTCAGGGACCTTCGACACGTCGATGTATTCTGTTCAGGAATCACAAAGGTGTGGTGACTACGAGGAATTTGACGGTGTTCTGACAGATTGGACAAAATTAGGACTCACCTTCGGGTGTATCAACTTATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

48

Amino Acids

5.16

Weight (kDa)

4.14

Isoelectric Point (pI)

36.39

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 142
AcsI RAATTY 1 cut(s) 80
AflIII ACRYGT 1 cut(s) 30
AjiI CACGTC 1 cut(s) 33
AleI CACNNNNGTG 1 cut(s) 61
ApoI RAATTY 1 cut(s) 80
AspS9I GGNCC 1 cut(s) 21
AsuHPI GGTGA 2 cut(s) 80, 112
AvaII GGWCC 1 cut(s) 21
Bme18I GGWCC 1 cut(s) 21
BmgBI CACGTC 1 cut(s) 33
BmgT120I GGNCC 1 cut(s) 21
BmiI GGNNCC 1 cut(s) 22
Bpu10I CCTNAGC 2 cut(s) 6, 16
BseMII CTCAG 1 cut(s) 30
BslFI GGGAC 1 cut(s) 34
BsmFI GGGAC 1 cut(s) 34
BspCNI CTCAG 1 cut(s) 29
BspLI GGNNCC 1 cut(s) 22
Bst4CI ACNGT 1 cut(s) 89
BstDEI CTNAG 2 cut(s) 6, 16
BtrI CACGTC 1 cut(s) 33
Cfr13I GGNCC 1 cut(s) 21
CviJI RGCY 2 cut(s) 5, 15
CviKI_1 RGCY 2 cut(s) 5, 15
DdeI CTNAG 2 cut(s) 6, 16
Eco47I GGWCC 1 cut(s) 21
EcoO109I RGGNCCY 1 cut(s) 21
FaiI YATR 1 cut(s) 142
FaqI GGGAC 1 cut(s) 34
HinfI GANTC 2 cut(s) 53, 117
HphI GGTGA 2 cut(s) 80, 112
Hpy188I TCNGA 1 cut(s) 96
Hpy188III TCNNGA 1 cut(s) 50
Hpy99I CGWCG 1 cut(s) 37
HpyAV CCTTC 2 cut(s) 34, 133
HpyCH4III ACNGT 1 cut(s) 89
HpyCH4IV ACGT 1 cut(s) 32
HpyF3I CTNAG 2 cut(s) 6, 16
HpySE526I ACGT 1 cut(s) 32
LpnPI CCDG 2 cut(s) 3, 35
MaeII ACGT 1 cut(s) 32
MaeIII GTNAC 1 cut(s) 68
MluCI AATT 2 cut(s) 80, 110
MlyI GAGTC 1 cut(s) 111
MnlI CCTC 2 cut(s) 5, 70
MslI CAYNNNNRTG 2 cut(s) 35, 61
NlaIV GGNNCC 1 cut(s) 22
NmuCI GTSAC 1 cut(s) 68
OliI CACNNNNGTG 1 cut(s) 61
PfeI GAWTC 1 cut(s) 53
PleI GAGTC 1 cut(s) 111
PpsI GAGTC 1 cut(s) 111
PpuMI RGGWCCY 1 cut(s) 21
PsiI TTATAA 1 cut(s) 142
Psp5II RGGWCCY 1 cut(s) 21
PspN4I GGNNCC 1 cut(s) 22
PspPI GGNCC 1 cut(s) 21
PspPPI RGGWCCY 1 cut(s) 21
RseI CAYNNNNRTG 2 cut(s) 35, 61
Sau96I GGNCC 1 cut(s) 21
SchI GAGTC 1 cut(s) 111
SetI ASST 4 cut(s) 26, 35, 65, 125
SgeI CNNG 5 cut(s) 30, 43, 62, 88, 139
SinI GGWCC 1 cut(s) 21
SmiMI CAYNNNNRTG 2 cut(s) 35, 61
Sse9I AATT 2 cut(s) 80, 110
TaaI ACNGT 1 cut(s) 89
TaiI ACGT 1 cut(s) 35
TaqI TCGA 2 cut(s) 27, 35
TasI AATT 2 cut(s) 80, 110
TfiI GAWTC 1 cut(s) 53
TseFI GTSAC 1 cut(s) 68
Tsp45I GTSAC 1 cut(s) 68
VpaK11BI GGWCC 1 cut(s) 21
XapI RAATTY 1 cut(s) 80
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.