MD02G1259800.v1.1

No description available

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr02
Physical Location & Seq
Reverse (-)
31338839 .. 31340629
1791 bp
Loading structure...
UTR
Exon/CDS
Intron
MD02G1259800.v1.1.491

Sequence Viewer

Length: 135 bp
ATGTGTGGTGCTAGGGAGTTGTTGGACGAACTCCAGGTTCAGGAATCACAAAGGTGTGGTGACTACGAGGAATTCGACGGTGTTCTGACAGATTGGACAAAATTAGGACTCACCTTCGGGTGTATCAACTTATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

45

Amino Acids

5.0

Weight (kDa)

4.05

Isoelectric Point (pI)

32.63

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 133
AcsI RAATTY 1 cut(s) 71
AfiI CCNNNNNNNGG 1 cut(s) 40
AjnI CCWGG 1 cut(s) 33
AleI CACNNNNGTG 1 cut(s) 52
ApoI RAATTY 1 cut(s) 71
AsuHPI GGTGA 2 cut(s) 71, 103
BciT130I CCWGG 1 cut(s) 35
BfaI CTAG 1 cut(s) 12
Bme1390I CCNGG 1 cut(s) 35
BmrFI CCNGG 1 cut(s) 35
BpmI CTGGAG 1 cut(s) 17
Bsc4I CCNNNNNNNGG 1 cut(s) 40
BseBI CCWGG 1 cut(s) 35
BseLI CCNNNNNNNGG 1 cut(s) 40
BslI CCNNNNNNNGG 1 cut(s) 40
Bst2UI CCWGG 1 cut(s) 35
Bst4CI ACNGT 1 cut(s) 80
BstNI CCWGG 1 cut(s) 35
BstSCI CCNGG 1 cut(s) 33
EcoRI GAATTC 1 cut(s) 71
EcoRII CCWGG 1 cut(s) 33
FaiI YATR 1 cut(s) 133
FspBI CTAG 1 cut(s) 12
GsuI CTGGAG 1 cut(s) 17
HinfI GANTC 2 cut(s) 44, 108
HphI GGTGA 2 cut(s) 71, 103
Hpy188I TCNGA 1 cut(s) 87
Hpy188III TCNNGA 1 cut(s) 41
Hpy99I CGWCG 1 cut(s) 80
HpyAV CCTTC 1 cut(s) 124
HpyCH4III ACNGT 1 cut(s) 80
LpnPI CCDG 3 cut(s) 20, 26, 47
MaeI CTAG 1 cut(s) 12
MaeIII GTNAC 1 cut(s) 59
MluCI AATT 2 cut(s) 71, 101
MlyI GAGTC 1 cut(s) 102
MnlI CCTC 1 cut(s) 61
MslI CAYNNNNRTG 1 cut(s) 52
MspR9I CCNGG 1 cut(s) 35
MvaI CCWGG 1 cut(s) 35
NmuCI GTSAC 1 cut(s) 59
OliI CACNNNNGTG 1 cut(s) 52
PcsI WCGNNNNNNNCGW 1 cut(s) 72
PfeI GAWTC 1 cut(s) 44
PleI GAGTC 1 cut(s) 102
PpsI GAGTC 1 cut(s) 102
PsiI TTATAA 1 cut(s) 133
Psp6I CCWGG 1 cut(s) 33
PspGI CCWGG 1 cut(s) 33
RseI CAYNNNNRTG 1 cut(s) 52
SchI GAGTC 1 cut(s) 102
ScrFI CCNGG 1 cut(s) 35
SetI ASST 3 cut(s) 39, 56, 116
SgeI CNNG 6 cut(s) 24, 46, 47, 53, 79, 130
SmiMI CAYNNNNRTG 1 cut(s) 52
Sse9I AATT 2 cut(s) 71, 101
SspMI CTAG 1 cut(s) 12
StyD4I CCNGG 1 cut(s) 33
TaaI ACNGT 1 cut(s) 80
TaqI TCGA 1 cut(s) 75
TasI AATT 2 cut(s) 71, 101
TfiI GAWTC 1 cut(s) 44
TseFI GTSAC 1 cut(s) 59
Tsp45I GTSAC 1 cut(s) 59
XapI RAATTY 1 cut(s) 71
XspI CTAG 1 cut(s) 12
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.