MD07G1181200.v1.1

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr07
OG0005201
Physical Location & Seq
Reverse (-)
26151881 .. 26154542
2662 bp
Loading structure...
UTR
Exon/CDS
Intron
MD07G1181200.v1.1.491

Sequence Viewer

Length: 147 bp
ATGTGTGGTGCTAGGGAGTTGTTGGACGAACTCCAGGTTCATGAATCACAAAGGTGTGGTGACTACGAGGAATTCGACGGTGTTCTGACAGATTGGACAAAATTAGGACTCACTTTCGGGTGTATCAACTTAGGAATTGTATCTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

49

Amino Acids

5.36

Weight (kDa)

4.2

Isoelectric Point (pI)

23.19

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 71
AjnI CCWGG 1 cut(s) 33
AleI CACNNNNGTG 1 cut(s) 52
ApoI RAATTY 1 cut(s) 71
AsuHPI GGTGA 1 cut(s) 71
BciT130I CCWGG 1 cut(s) 35
BfaI CTAG 1 cut(s) 12
Bme1390I CCNGG 1 cut(s) 35
BmrFI CCNGG 1 cut(s) 35
BpmI CTGGAG 1 cut(s) 17
BseBI CCWGG 1 cut(s) 35
BspHI TCATGA 1 cut(s) 40
Bst2UI CCWGG 1 cut(s) 35
Bst4CI ACNGT 1 cut(s) 80
BstDEI CTNAG 1 cut(s) 130
BstNI CCWGG 1 cut(s) 35
BstSCI CCNGG 1 cut(s) 33
CciI TCATGA 1 cut(s) 40
CviAII CATG 1 cut(s) 41
DdeI CTNAG 1 cut(s) 130
EcoRI GAATTC 1 cut(s) 71
EcoRII CCWGG 1 cut(s) 33
FaeI CATG 1 cut(s) 44
FaiI YATR 1 cut(s) 42
FatI CATG 1 cut(s) 40
FspBI CTAG 1 cut(s) 12
GsuI CTGGAG 1 cut(s) 17
Hin1II CATG 1 cut(s) 44
HinfI GANTC 2 cut(s) 44, 108
HphI GGTGA 1 cut(s) 71
Hpy188I TCNGA 1 cut(s) 87
Hpy188III TCNNGA 1 cut(s) 41
Hpy99I CGWCG 1 cut(s) 80
HpyCH4III ACNGT 1 cut(s) 80
HpyF3I CTNAG 1 cut(s) 130
Hsp92II CATG 1 cut(s) 44
LpnPI CCDG 2 cut(s) 20, 47
MaeI CTAG 1 cut(s) 12
MaeIII GTNAC 1 cut(s) 59
MluCI AATT 3 cut(s) 71, 101, 135
MlyI GAGTC 1 cut(s) 102
MnlI CCTC 1 cut(s) 61
MseI TTAA 1 cut(s) 145
MslI CAYNNNNRTG 1 cut(s) 52
MspR9I CCNGG 1 cut(s) 35
MvaI CCWGG 1 cut(s) 35
NlaIII CATG 1 cut(s) 44
NmuCI GTSAC 1 cut(s) 59
OliI CACNNNNGTG 1 cut(s) 52
PagI TCATGA 1 cut(s) 40
PcsI WCGNNNNNNNCGW 1 cut(s) 72
PfeI GAWTC 1 cut(s) 44
PleI GAGTC 1 cut(s) 102
PpsI GAGTC 1 cut(s) 102
Psp6I CCWGG 1 cut(s) 33
PspGI CCWGG 1 cut(s) 33
RseI CAYNNNNRTG 1 cut(s) 52
SaqAI TTAA 1 cut(s) 145
SchI GAGTC 1 cut(s) 102
ScrFI CCNGG 1 cut(s) 35
SetI ASST 2 cut(s) 39, 56
SgeI CNNG 6 cut(s) 24, 46, 47, 53, 79, 130
SmiMI CAYNNNNRTG 1 cut(s) 52
Sse9I AATT 3 cut(s) 71, 101, 135
SspMI CTAG 1 cut(s) 12
StyD4I CCNGG 1 cut(s) 33
TaaI ACNGT 1 cut(s) 80
TaqI TCGA 1 cut(s) 75
TasI AATT 3 cut(s) 71, 101, 135
TfiI GAWTC 1 cut(s) 44
Tru1I TTAA 1 cut(s) 145
Tru9I TTAA 1 cut(s) 145
TseFI GTSAC 1 cut(s) 59
Tsp45I GTSAC 1 cut(s) 59
TspDTI ATGAA 2 cut(s) 29, 57
XapI RAATTY 1 cut(s) 71
XspI CTAG 1 cut(s) 12
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.