MD09G1163200.v1.1

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr09
OG0005201
Physical Location & Seq
Forward (+)
13307648 .. 13310178
2531 bp
Loading structure...
UTR
Exon/CDS
Intron
MD09G1163200.v1.1.491

Sequence Viewer

Length: 189 bp
ATGTGTGGTGCTAGGGAGTTGTTGGACGAACTCCAGGTTCAGGAATCACAAAGGTGTGGTGACTACGAGGAATTCGACGGTGTTCTGACAGATTGGACAAAAATTAGGACTCACCTTCGGGTGTATCAACTTATAAATTGTATCTTAAAGCTTCCGTACTGTGCAAATGGTTACGTCACTCTCACGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

63

Amino Acids

7.23

Weight (kDa)

4.83

Isoelectric Point (pI)

23.81

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 134
AcsI RAATTY 1 cut(s) 71
AcvI CACGTG 1 cut(s) 186
AfaI GTAC 1 cut(s) 158
AfiI CCNNNNNNNGG 1 cut(s) 40
AjnI CCWGG 1 cut(s) 33
AleI CACNNNNGTG 1 cut(s) 52
AluBI AGCT 1 cut(s) 151
AluI AGCT 1 cut(s) 151
ApoI RAATTY 1 cut(s) 71
AsuHPI GGTGA 2 cut(s) 71, 104
BbrPI CACGTG 1 cut(s) 186
BciT130I CCWGG 1 cut(s) 35
BfaI CTAG 1 cut(s) 12
Bme1390I CCNGG 1 cut(s) 35
BmrFI CCNGG 1 cut(s) 35
BpmI CTGGAG 1 cut(s) 17
BsaAI YACGTR 1 cut(s) 186
Bsc4I CCNNNNNNNGG 1 cut(s) 40
BseBI CCWGG 1 cut(s) 35
BseLI CCNNNNNNNGG 1 cut(s) 40
BslI CCNNNNNNNGG 1 cut(s) 40
Bst2UI CCWGG 1 cut(s) 35
Bst4CI ACNGT 2 cut(s) 80, 161
BstBAI YACGTR 1 cut(s) 186
BstNI CCWGG 1 cut(s) 35
BstSCI CCNGG 1 cut(s) 33
Csp6I GTAC 1 cut(s) 157
CviJI RGCY 1 cut(s) 151
CviKI_1 RGCY 1 cut(s) 151
CviQI GTAC 1 cut(s) 157
Eco72I CACGTG 1 cut(s) 186
EcoRI GAATTC 1 cut(s) 71
EcoRII CCWGG 1 cut(s) 33
FaiI YATR 1 cut(s) 134
FspBI CTAG 1 cut(s) 12
GsuI CTGGAG 1 cut(s) 17
HindIII AAGCTT 1 cut(s) 149
HinfI GANTC 2 cut(s) 44, 109
HphI GGTGA 2 cut(s) 71, 104
Hpy188I TCNGA 1 cut(s) 87
Hpy188III TCNNGA 1 cut(s) 41
Hpy99I CGWCG 1 cut(s) 80
HpyAV CCTTC 1 cut(s) 125
HpyCH4III ACNGT 2 cut(s) 80, 161
HpyCH4IV ACGT 2 cut(s) 174, 185
HpyCH4V TGCA 1 cut(s) 164
HpySE526I ACGT 2 cut(s) 174, 185
LpnPI CCDG 3 cut(s) 20, 26, 47
MaeI CTAG 1 cut(s) 12
MaeII ACGT 2 cut(s) 174, 185
MaeIII GTNAC 3 cut(s) 59, 170, 175
MluCI AATT 3 cut(s) 71, 102, 136
MlyI GAGTC 1 cut(s) 103
MnlI CCTC 1 cut(s) 61
MseI TTAA 1 cut(s) 146
MslI CAYNNNNRTG 1 cut(s) 52
MspR9I CCNGG 1 cut(s) 35
MvaI CCWGG 1 cut(s) 35
NmuCI GTSAC 2 cut(s) 59, 175
OliI CACNNNNGTG 1 cut(s) 52
PcsI WCGNNNNNNNCGW 1 cut(s) 72
PfeI GAWTC 1 cut(s) 44
PleI GAGTC 1 cut(s) 103
PmaCI CACGTG 1 cut(s) 186
PmlI CACGTG 1 cut(s) 186
PpsI GAGTC 1 cut(s) 103
Ppu21I YACGTR 1 cut(s) 186
PsiI TTATAA 1 cut(s) 134
Psp6I CCWGG 1 cut(s) 33
PspCI CACGTG 1 cut(s) 186
PspGI CCWGG 1 cut(s) 33
RsaI GTAC 1 cut(s) 158
RsaNI GTAC 1 cut(s) 157
RseI CAYNNNNRTG 1 cut(s) 52
SaqAI TTAA 1 cut(s) 146
SchI GAGTC 1 cut(s) 103
ScrFI CCNGG 1 cut(s) 35
SetI ASST 6 cut(s) 39, 56, 117, 153, 177, 188
SgeI CNNG 6 cut(s) 24, 46, 47, 53, 79, 131
SmiMI CAYNNNNRTG 1 cut(s) 52
Sse9I AATT 3 cut(s) 71, 102, 136
SspMI CTAG 1 cut(s) 12
StyD4I CCNGG 1 cut(s) 33
TaaI ACNGT 2 cut(s) 80, 161
TaiI ACGT 2 cut(s) 177, 188
TaqI TCGA 1 cut(s) 75
TasI AATT 3 cut(s) 71, 102, 136
TfiI GAWTC 1 cut(s) 44
Tru1I TTAA 1 cut(s) 146
Tru9I TTAA 1 cut(s) 146
TseFI GTSAC 2 cut(s) 59, 175
Tsp45I GTSAC 2 cut(s) 59, 175
TspGWI ACGGA 1 cut(s) 144
XapI RAATTY 1 cut(s) 71
XspI CTAG 1 cut(s) 12
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.