MD15G1177200.v1.1

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr15
OG0005201
Physical Location & Seq
Forward (+)
13869438 .. 13876182
6745 bp
Loading structure...
UTR
Exon/CDS
Intron
MD15G1177200.v1.1.491

Sequence Viewer

Length: 177 bp
ATGCTGTTTTATGAGTTGATGGATGAAGTTCAGGAATCACAAAGGTGTGGTGACTACGAGGAATTCGACGGTGTTCTGACAGATTGGACAAAATTAGGACTCACCTTCAGGTGTATCAATTTAAATTGTATCTTAAAGCTTCCGTACTGTGCAAATGGTTACGTCACTCTCACGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

59

Amino Acids

6.78

Weight (kDa)

4.21

Isoelectric Point (pI)

26.33

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 62
AcuI CTGAAG 1 cut(s) 91
AcvI CACGTG 1 cut(s) 174
AfaI GTAC 1 cut(s) 146
AleI CACNNNNGTG 1 cut(s) 43
AluBI AGCT 1 cut(s) 139
AluI AGCT 1 cut(s) 139
ApoI RAATTY 1 cut(s) 62
AsuHPI GGTGA 2 cut(s) 62, 94
BbrPI CACGTG 1 cut(s) 174
BccI CCATC 1 cut(s) 13
BsaAI YACGTR 1 cut(s) 174
BseGI GGATG 1 cut(s) 28
Bst4CI ACNGT 2 cut(s) 71, 149
BstBAI YACGTR 1 cut(s) 174
BstF5I GGATG 1 cut(s) 28
BtsCI GGATG 1 cut(s) 28
Csp6I GTAC 1 cut(s) 145
CviJI RGCY 1 cut(s) 139
CviKI_1 RGCY 1 cut(s) 139
CviQI GTAC 1 cut(s) 145
DraI TTTAAA 1 cut(s) 123
Eco57I CTGAAG 1 cut(s) 91
Eco72I CACGTG 1 cut(s) 174
EcoRI GAATTC 1 cut(s) 62
FaiI YATR 1 cut(s) 12
FokI GGATG 1 cut(s) 35
HindIII AAGCTT 1 cut(s) 137
HinfI GANTC 2 cut(s) 35, 99
HphI GGTGA 2 cut(s) 62, 94
Hpy188I TCNGA 1 cut(s) 78
Hpy188III TCNNGA 1 cut(s) 32
Hpy99I CGWCG 1 cut(s) 71
HpyAV CCTTC 1 cut(s) 115
HpyCH4III ACNGT 2 cut(s) 71, 149
HpyCH4IV ACGT 2 cut(s) 162, 173
HpyCH4V TGCA 1 cut(s) 152
HpySE526I ACGT 2 cut(s) 162, 173
LpnPI CCDG 2 cut(s) 17, 94
MaeII ACGT 2 cut(s) 162, 173
MaeIII GTNAC 3 cut(s) 50, 158, 163
MluCI AATT 4 cut(s) 62, 92, 118, 124
MlyI GAGTC 1 cut(s) 93
MnlI CCTC 1 cut(s) 52
MseI TTAA 2 cut(s) 122, 134
MslI CAYNNNNRTG 1 cut(s) 43
NmuCI GTSAC 2 cut(s) 50, 163
OliI CACNNNNGTG 1 cut(s) 43
PcsI WCGNNNNNNNCGW 1 cut(s) 63
PfeI GAWTC 1 cut(s) 35
PleI GAGTC 1 cut(s) 93
PmaCI CACGTG 1 cut(s) 174
PmlI CACGTG 1 cut(s) 174
PpsI GAGTC 1 cut(s) 93
Ppu21I YACGTR 1 cut(s) 174
PspCI CACGTG 1 cut(s) 174
RsaI GTAC 1 cut(s) 146
RsaNI GTAC 1 cut(s) 145
RseI CAYNNNNRTG 1 cut(s) 43
SaqAI TTAA 2 cut(s) 122, 134
SchI GAGTC 1 cut(s) 93
SetI ASST 6 cut(s) 47, 107, 113, 141, 165, 176
SgeI CNNG 3 cut(s) 44, 70, 121
SmiI ATTTAAAT 1 cut(s) 123
SmiMI CAYNNNNRTG 1 cut(s) 43
Sse9I AATT 4 cut(s) 62, 92, 118, 124
SwaI ATTTAAAT 1 cut(s) 123
TaaI ACNGT 2 cut(s) 71, 149
TaiI ACGT 2 cut(s) 165, 176
TaqI TCGA 1 cut(s) 66
TasI AATT 4 cut(s) 62, 92, 118, 124
TfiI GAWTC 1 cut(s) 35
Tru1I TTAA 2 cut(s) 122, 134
Tru9I TTAA 2 cut(s) 122, 134
TseFI GTSAC 2 cut(s) 50, 163
Tsp45I GTSAC 2 cut(s) 50, 163
TspDTI ATGAA 1 cut(s) 39
TspGWI ACGGA 1 cut(s) 132
XapI RAATTY 1 cut(s) 62
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.