MD17G1041200.v1.1

No description available

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr17
Physical Location & Seq
Reverse (-)
2998073 .. 3000494
2422 bp
Loading structure...
UTR
Exon/CDS
Intron
MD17G1041200.v1.1.491

Sequence Viewer

Length: 186 bp
ATGTGTGGTGCTAGGGAGTTGTTGGACGAACTCCAGGTTCAGGAATCACAAAGGTGTGGTGACTACGAGGAATTCGACGGTGTTCTGACAGATTGGACAAAATTAGGACTCACCTTCGGGTGTATCAATTTAAATTGTATCTTAAAGCTTCCGTACTGTGCAAATGGTTACGTCACTCTCACGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

62

Amino Acids

6.87

Weight (kDa)

4.21

Isoelectric Point (pI)

24.13

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 71
AcvI CACGTG 1 cut(s) 183
AfaI GTAC 1 cut(s) 155
AfiI CCNNNNNNNGG 1 cut(s) 40
AjnI CCWGG 1 cut(s) 33
AleI CACNNNNGTG 1 cut(s) 52
AluBI AGCT 1 cut(s) 148
AluI AGCT 1 cut(s) 148
ApoI RAATTY 1 cut(s) 71
AsuHPI GGTGA 2 cut(s) 71, 103
BbrPI CACGTG 1 cut(s) 183
BciT130I CCWGG 1 cut(s) 35
BfaI CTAG 1 cut(s) 12
Bme1390I CCNGG 1 cut(s) 35
BmrFI CCNGG 1 cut(s) 35
BpmI CTGGAG 1 cut(s) 17
BsaAI YACGTR 1 cut(s) 183
Bsc4I CCNNNNNNNGG 1 cut(s) 40
BseBI CCWGG 1 cut(s) 35
BseLI CCNNNNNNNGG 1 cut(s) 40
BslI CCNNNNNNNGG 1 cut(s) 40
Bst2UI CCWGG 1 cut(s) 35
Bst4CI ACNGT 2 cut(s) 80, 158
BstBAI YACGTR 1 cut(s) 183
BstNI CCWGG 1 cut(s) 35
BstSCI CCNGG 1 cut(s) 33
Csp6I GTAC 1 cut(s) 154
CviJI RGCY 1 cut(s) 148
CviKI_1 RGCY 1 cut(s) 148
CviQI GTAC 1 cut(s) 154
DraI TTTAAA 1 cut(s) 132
Eco72I CACGTG 1 cut(s) 183
EcoRI GAATTC 1 cut(s) 71
EcoRII CCWGG 1 cut(s) 33
FspBI CTAG 1 cut(s) 12
GsuI CTGGAG 1 cut(s) 17
HindIII AAGCTT 1 cut(s) 146
HinfI GANTC 2 cut(s) 44, 108
HphI GGTGA 2 cut(s) 71, 103
Hpy188I TCNGA 1 cut(s) 87
Hpy188III TCNNGA 1 cut(s) 41
Hpy99I CGWCG 1 cut(s) 80
HpyAV CCTTC 1 cut(s) 124
HpyCH4III ACNGT 2 cut(s) 80, 158
HpyCH4IV ACGT 2 cut(s) 171, 182
HpyCH4V TGCA 1 cut(s) 161
HpySE526I ACGT 2 cut(s) 171, 182
LpnPI CCDG 3 cut(s) 20, 26, 47
MaeI CTAG 1 cut(s) 12
MaeII ACGT 2 cut(s) 171, 182
MaeIII GTNAC 3 cut(s) 59, 167, 172
MluCI AATT 4 cut(s) 71, 101, 127, 133
MlyI GAGTC 1 cut(s) 102
MnlI CCTC 1 cut(s) 61
MseI TTAA 2 cut(s) 131, 143
MslI CAYNNNNRTG 1 cut(s) 52
MspR9I CCNGG 1 cut(s) 35
MvaI CCWGG 1 cut(s) 35
NmuCI GTSAC 2 cut(s) 59, 172
OliI CACNNNNGTG 1 cut(s) 52
PcsI WCGNNNNNNNCGW 1 cut(s) 72
PfeI GAWTC 1 cut(s) 44
PleI GAGTC 1 cut(s) 102
PmaCI CACGTG 1 cut(s) 183
PmlI CACGTG 1 cut(s) 183
PpsI GAGTC 1 cut(s) 102
Ppu21I YACGTR 1 cut(s) 183
Psp6I CCWGG 1 cut(s) 33
PspCI CACGTG 1 cut(s) 183
PspGI CCWGG 1 cut(s) 33
RsaI GTAC 1 cut(s) 155
RsaNI GTAC 1 cut(s) 154
RseI CAYNNNNRTG 1 cut(s) 52
SaqAI TTAA 2 cut(s) 131, 143
SchI GAGTC 1 cut(s) 102
ScrFI CCNGG 1 cut(s) 35
SetI ASST 6 cut(s) 39, 56, 116, 150, 174, 185
SgeI CNNG 6 cut(s) 24, 46, 47, 53, 79, 130
SmiI ATTTAAAT 1 cut(s) 132
SmiMI CAYNNNNRTG 1 cut(s) 52
Sse9I AATT 4 cut(s) 71, 101, 127, 133
SspMI CTAG 1 cut(s) 12
StyD4I CCNGG 1 cut(s) 33
SwaI ATTTAAAT 1 cut(s) 132
TaaI ACNGT 2 cut(s) 80, 158
TaiI ACGT 2 cut(s) 174, 185
TaqI TCGA 1 cut(s) 75
TasI AATT 4 cut(s) 71, 101, 127, 133
TfiI GAWTC 1 cut(s) 44
Tru1I TTAA 2 cut(s) 131, 143
Tru9I TTAA 2 cut(s) 131, 143
TseFI GTSAC 2 cut(s) 59, 172
Tsp45I GTSAC 2 cut(s) 59, 172
TspGWI ACGGA 1 cut(s) 141
XapI RAATTY 1 cut(s) 71
XspI CTAG 1 cut(s) 12
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.