MD15G1445300.v1.1

No description available

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr15
Physical Location & Seq
Forward (+)
54707423 .. 54709389
1967 bp
Loading structure...
UTR
Exon/CDS
Intron
MD15G1445300.v1.1.491

Sequence Viewer

Length: 135 bp
ATGTGTGGTGCTAGGGAGTTGTTGGACGAACTCCAGGTTCAGGAATCACAAAGGTGTGGTGACTACGAGGAATTCGACGGTGTTCTGACAGAATGGACCAAATTAGGACGCACCTTCGGGTGTATCAACTTATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

45

Amino Acids

5.05

Weight (kDa)

4.25

Isoelectric Point (pI)

33.59

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 133
AcsI RAATTY 1 cut(s) 71
AfiI CCNNNNNNNGG 1 cut(s) 40
AjnI CCWGG 1 cut(s) 33
AleI CACNNNNGTG 1 cut(s) 52
ApoI RAATTY 1 cut(s) 71
AspS9I GGNCC 1 cut(s) 96
AsuHPI GGTGA 1 cut(s) 71
AvaII GGWCC 1 cut(s) 96
BciT130I CCWGG 1 cut(s) 35
BfaI CTAG 1 cut(s) 12
Bme1390I CCNGG 1 cut(s) 35
Bme18I GGWCC 1 cut(s) 96
BmgT120I GGNCC 1 cut(s) 96
BmrFI CCNGG 1 cut(s) 35
BpmI CTGGAG 1 cut(s) 17
Bsc4I CCNNNNNNNGG 1 cut(s) 40
BseBI CCWGG 1 cut(s) 35
BseLI CCNNNNNNNGG 1 cut(s) 40
BslI CCNNNNNNNGG 1 cut(s) 40
Bst2UI CCWGG 1 cut(s) 35
Bst4CI ACNGT 1 cut(s) 80
BstNI CCWGG 1 cut(s) 35
BstSCI CCNGG 1 cut(s) 33
Cfr13I GGNCC 1 cut(s) 96
CseI GACGC 1 cut(s) 117
Eco47I GGWCC 1 cut(s) 96
EcoRI GAATTC 1 cut(s) 71
EcoRII CCWGG 1 cut(s) 33
FaiI YATR 1 cut(s) 133
FspBI CTAG 1 cut(s) 12
GsuI CTGGAG 1 cut(s) 17
HgaI GACGC 1 cut(s) 117
HinfI GANTC 1 cut(s) 44
HphI GGTGA 1 cut(s) 71
Hpy188I TCNGA 1 cut(s) 87
Hpy188III TCNNGA 1 cut(s) 41
Hpy99I CGWCG 1 cut(s) 80
HpyAV CCTTC 1 cut(s) 124
HpyCH4III ACNGT 1 cut(s) 80
LpnPI CCDG 3 cut(s) 20, 26, 47
MaeI CTAG 1 cut(s) 12
MaeIII GTNAC 1 cut(s) 59
MluCI AATT 2 cut(s) 71, 101
MnlI CCTC 1 cut(s) 61
MslI CAYNNNNRTG 1 cut(s) 52
MspR9I CCNGG 1 cut(s) 35
MvaI CCWGG 1 cut(s) 35
NmuCI GTSAC 1 cut(s) 59
OliI CACNNNNGTG 1 cut(s) 52
PcsI WCGNNNNNNNCGW 1 cut(s) 72
PfeI GAWTC 1 cut(s) 44
PsiI TTATAA 1 cut(s) 133
Psp6I CCWGG 1 cut(s) 33
PspGI CCWGG 1 cut(s) 33
PspPI GGNCC 1 cut(s) 96
RseI CAYNNNNRTG 1 cut(s) 52
Sau96I GGNCC 1 cut(s) 96
ScrFI CCNGG 1 cut(s) 35
SetI ASST 3 cut(s) 39, 56, 116
SgeI CNNG 6 cut(s) 24, 46, 47, 53, 79, 130
SinI GGWCC 1 cut(s) 96
SmiMI CAYNNNNRTG 1 cut(s) 52
Sse9I AATT 2 cut(s) 71, 101
SspMI CTAG 1 cut(s) 12
StyD4I CCNGG 1 cut(s) 33
TaaI ACNGT 1 cut(s) 80
TaqI TCGA 1 cut(s) 75
TasI AATT 2 cut(s) 71, 101
TfiI GAWTC 1 cut(s) 44
TseFI GTSAC 1 cut(s) 59
Tsp45I GTSAC 1 cut(s) 59
VpaK11BI GGWCC 1 cut(s) 96
XapI RAATTY 1 cut(s) 71
XspI CTAG 1 cut(s) 12
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.