MD15G1392300.v1.1

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr15
OG0005201
Physical Location & Seq
Reverse (-)
48965130 .. 48966384
1255 bp
Loading structure...
UTR
Exon/CDS
Intron
MD15G1392300.v1.1.491

Sequence Viewer

Length: 159 bp
ATGCCAGTCGTTCTAGATAGCAGAGCTGGTGGCCACGAGGAATCCAACGGTGTTCTGACAGAATTCATAAAAGTAGGACTCACCCTCGGGTGTTTCATCTTAGTAATTGTATTTTTAAAGCTTCCGAACTGTGTAAATGGTTACGTCACTCTCACGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

53

Amino Acids

5.58

Weight (kDa)

5.51

Isoelectric Point (pI)

31.98

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 31
AcsI RAATTY 1 cut(s) 62
AcvI CACGTG 1 cut(s) 156
AluBI AGCT 2 cut(s) 26, 121
AluI AGCT 2 cut(s) 26, 121
Ama87I CYCGRG 1 cut(s) 86
AoxI GGCC 1 cut(s) 31
ApoI RAATTY 1 cut(s) 62
AsuHPI GGTGA 1 cut(s) 73
AvaI CYCGRG 1 cut(s) 86
BalI TGGCCA 1 cut(s) 33
BauI CACGAG 1 cut(s) 35
BbrPI CACGTG 1 cut(s) 156
BfaI CTAG 1 cut(s) 14
BmeT110I CYCGRG 1 cut(s) 86
BsaAI YACGTR 1 cut(s) 156
BsaJI CCNNGG 1 cut(s) 85
Bse1I ACTGG 1 cut(s) 5
BseDI CCNNGG 1 cut(s) 85
BseNI ACTGG 1 cut(s) 5
BshFI GGCC 1 cut(s) 33
BsiHKCI CYCGRG 1 cut(s) 86
BsnI GGCC 1 cut(s) 33
BsoBI CYCGRG 1 cut(s) 86
BspANI GGCC 1 cut(s) 33
BsrI ACTGG 1 cut(s) 5
BssECI CCNNGG 1 cut(s) 85
BssSI CACGAG 1 cut(s) 35
Bst2BI CACGAG 1 cut(s) 35
Bst4CI ACNGT 2 cut(s) 50, 131
BstBAI YACGTR 1 cut(s) 156
BstDEI CTNAG 1 cut(s) 100
BsuRI GGCC 1 cut(s) 33
CviJI RGCY 3 cut(s) 26, 33, 121
CviKI_1 RGCY 3 cut(s) 26, 33, 121
DdeI CTNAG 1 cut(s) 100
DraI TTTAAA 1 cut(s) 117
EaeI YGGCCR 1 cut(s) 31
Eco72I CACGTG 1 cut(s) 156
Eco88I CYCGRG 1 cut(s) 86
EcoRI GAATTC 1 cut(s) 62
FaiI YATR 1 cut(s) 68
FspBI CTAG 1 cut(s) 14
HaeIII GGCC 1 cut(s) 33
HindIII AAGCTT 1 cut(s) 119
HinfI GANTC 2 cut(s) 41, 78
HphI GGTGA 1 cut(s) 73
Hpy188I TCNGA 2 cut(s) 57, 126
Hpy188III TCNNGA 1 cut(s) 14
HpyCH4III ACNGT 2 cut(s) 50, 131
HpyCH4IV ACGT 2 cut(s) 144, 155
HpyF3I CTNAG 1 cut(s) 100
HpySE526I ACGT 2 cut(s) 144, 155
LpnPI CCDG 2 cut(s) 12, 18
MaeI CTAG 1 cut(s) 14
MaeII ACGT 2 cut(s) 144, 155
MaeIII GTNAC 2 cut(s) 140, 145
MlsI TGGCCA 1 cut(s) 33
MluCI AATT 2 cut(s) 62, 105
MluNI TGGCCA 1 cut(s) 33
MlyI GAGTC 1 cut(s) 72
MmeI TCCRAC 1 cut(s) 69
MnlI CCTC 2 cut(s) 31, 95
Mox20I TGGCCA 1 cut(s) 33
MscI TGGCCA 1 cut(s) 33
MseI TTAA 1 cut(s) 116
Msp20I TGGCCA 1 cut(s) 33
NmuCI GTSAC 1 cut(s) 145
PfeI GAWTC 1 cut(s) 41
PleI GAGTC 1 cut(s) 72
PmaCI CACGTG 1 cut(s) 156
PmlI CACGTG 1 cut(s) 156
PpsI GAGTC 1 cut(s) 72
Ppu21I YACGTR 1 cut(s) 156
PspCI CACGTG 1 cut(s) 156
SaqAI TTAA 1 cut(s) 116
SchI GAGTC 1 cut(s) 72
SetI ASST 4 cut(s) 28, 123, 147, 158
SgeI CNNG 7 cut(s) 17, 26, 39, 47, 49, 98, 100
Sse9I AATT 2 cut(s) 62, 105
SspMI CTAG 1 cut(s) 14
TaaI ACNGT 2 cut(s) 50, 131
TaiI ACGT 2 cut(s) 147, 158
TasI AATT 2 cut(s) 62, 105
TfiI GAWTC 1 cut(s) 41
Tru1I TTAA 1 cut(s) 116
Tru9I TTAA 1 cut(s) 116
TseFI GTSAC 1 cut(s) 145
Tsp45I GTSAC 1 cut(s) 145
TspDTI ATGAA 2 cut(s) 55, 85
XapI RAATTY 1 cut(s) 62
XbaI TCTAGA 1 cut(s) 13
XspI CTAG 1 cut(s) 14
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.