MD02G1044100.v1.1

Belongs to the thiamine pyrophosphokinase family

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr02
Physical Location & Seq
Forward (+)
3588012 .. 3588441
430 bp
Loading structure...
UTR
Exon/CDS
Intron
MD02G1044100.v1.1.491

Sequence Viewer

Length: 165 bp
ATGCCATCTGGAAGTACTACAACCACTGGACTTCAATGGGATCTCGCTGAAACGGAGATGAGGTTTGGTGGTCTGATAAGTACATCGAATATCGTCAAGGGAGAGAAAATAACAGTGCAGTCAGATTCAGATCTTCTATGGACTATAAGCATTAAAAAGATGTAG

Protein Analysis

55

Amino Acids

5.9

Weight (kDa)

4.99

Isoelectric Point (pI)

49.7

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
TPK_B1_binding PF04265 4 - 46 6.9e-14 Thiamin pyrophosphokinase, vitamin B1 binding domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AclWI GGATC 1 cut(s) 48
AfaI GTAC 2 cut(s) 16, 82
AgsI TTSAA 1 cut(s) 35
AlwI GGATC 1 cut(s) 48
BccI CCATC 1 cut(s) 13
BglII AGATCT 1 cut(s) 130
BmcAI AGTACT 1 cut(s) 16
BsaBI GATNNNNATC 1 cut(s) 129
BsaXI ACNNNNNCTCC 2 cut(s) 47, 77
Bse1I ACTGG 1 cut(s) 31
Bse8I GATNNNNATC 1 cut(s) 129
BseJI GATNNNNATC 1 cut(s) 129
BseNI ACTGG 1 cut(s) 31
BsgI GTGCAG 1 cut(s) 137
Bsp143I GATC 2 cut(s) 40, 130
BspPI GGATC 1 cut(s) 48
BsrI ACTGG 1 cut(s) 31
BssMI GATC 2 cut(s) 40, 130
Bst4CI ACNGT 1 cut(s) 115
BstKTI GATC 2 cut(s) 43, 133
BstMBI GATC 2 cut(s) 40, 130
BstX2I RGATCY 2 cut(s) 40, 130
BstYI RGATCY 2 cut(s) 40, 130
BtsIMutI CAGTG 2 cut(s) 24, 120
Csp6I GTAC 2 cut(s) 15, 81
CviQI GTAC 2 cut(s) 15, 81
DpnI GATC 2 cut(s) 42, 132
DpnII GATC 2 cut(s) 40, 130
FaiI YATR 2 cut(s) 139, 146
HinfI GANTC 1 cut(s) 125
Hpy188I TCNGA 3 cut(s) 75, 124, 130
Hpy188III TCNNGA 1 cut(s) 9
HpyCH4III ACNGT 1 cut(s) 115
HpyCH4V TGCA 1 cut(s) 118
Kzo9I GATC 2 cut(s) 40, 130
LpnPI CCDG 1 cut(s) 12
MalI GATC 2 cut(s) 42, 132
MboI GATC 2 cut(s) 40, 130
MboII GAAGA 1 cut(s) 125
MflI RGATCY 2 cut(s) 40, 130
MnlI CCTC 1 cut(s) 54
MseI TTAA 1 cut(s) 153
NdeII GATC 2 cut(s) 40, 130
PfeI GAWTC 1 cut(s) 125
PsuI RGATCY 2 cut(s) 40, 130
RsaI GTAC 2 cut(s) 16, 82
RsaNI GTAC 2 cut(s) 15, 81
SaqAI TTAA 1 cut(s) 153
Sau3AI GATC 2 cut(s) 40, 130
ScaI AGTACT 1 cut(s) 16
SetI ASST 1 cut(s) 65
SgeI CNNG 4 cut(s) 21, 39, 56, 109
TaaI ACNGT 1 cut(s) 115
TaqI TCGA 1 cut(s) 86
TatI WGTACW 2 cut(s) 14, 80
TfiI GAWTC 1 cut(s) 125
Tru1I TTAA 1 cut(s) 153
Tru9I TTAA 1 cut(s) 153
TscAI CASTG 2 cut(s) 31, 120
TspGWI ACGGA 1 cut(s) 68
TspRI CASTG 2 cut(s) 31, 120
ZrmI AGTACT 1 cut(s) 16
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.