MD02G1147500.v1.1

Protein N-lysine methyltransferase

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr02
Physical Location & Seq
Forward (+)
12170865 .. 12171070
206 bp
Loading structure...
UTR
Exon/CDS
Intron
MD02G1147500.v1.1.491

Sequence Viewer

Length: 186 bp
ATGAGGCGGTGGAAGAAGGACTCGGCTTTCTTCAAGAAAGCCAGGAAGCTTTTCGAGGTGGAGGTCTTGCACGTGGACCCCCCGTGCCTTGGCTCCCGGGTTGGAGTTGCCGTTTACCGTTTAACCGCCAAAAAGTCGAGTAGGAAAATGTTGAATTCTGTTGACAATGCTAATGTTATCGCCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

62

Amino Acids

6.96

Weight (kDa)

10.5

Isoelectric Point (pI)

36.25

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0012035)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 2 cut(s) 7, 126
AcsI RAATTY 1 cut(s) 154
AcvI CACGTG 1 cut(s) 73
AfiI CCNNNNNNNGG 1 cut(s) 89
AgsI TTSAA 2 cut(s) 34, 154
AjnI CCWGG 1 cut(s) 41
AluBI AGCT 1 cut(s) 49
AluI AGCT 1 cut(s) 49
Ama87I CYCGRG 1 cut(s) 96
ApoI RAATTY 1 cut(s) 154
Asp700I GAANNNNTTC 1 cut(s) 50
AspS9I GGNCC 1 cut(s) 76
AsuC2I CCSGG 2 cut(s) 97, 98
AvaI CYCGRG 1 cut(s) 96
AvaII GGWCC 1 cut(s) 76
BbrPI CACGTG 1 cut(s) 73
BceAI ACGGC 1 cut(s) 95
BciT130I CCWGG 1 cut(s) 43
BcnI CCSGG 2 cut(s) 97, 98
Bme1390I CCNGG 3 cut(s) 43, 97, 98
Bme18I GGWCC 1 cut(s) 76
BmeT110I CYCGRG 1 cut(s) 96
BmgT120I GGNCC 1 cut(s) 76
BmiI GGNNCC 2 cut(s) 78, 94
BmrFI CCNGG 3 cut(s) 43, 97, 98
BpuMI CCSGG 2 cut(s) 97, 98
BsaAI YACGTR 1 cut(s) 73
BsaJI CCNNGG 2 cut(s) 88, 96
BsaXI ACNNNNNCTCC 2 cut(s) 96, 126
Bsc4I CCNNNNNNNGG 1 cut(s) 89
BseBI CCWGG 1 cut(s) 43
BseDI CCNNGG 2 cut(s) 88, 96
BseLI CCNNNNNNNGG 1 cut(s) 89
BsiHKCI CYCGRG 1 cut(s) 96
BsiSI CCGG 1 cut(s) 97
BslI CCNNNNNNNGG 1 cut(s) 89
BsoBI CYCGRG 1 cut(s) 96
BspACI CCGC 2 cut(s) 7, 126
BspLI GGNNCC 2 cut(s) 78, 94
BssECI CCNNGG 2 cut(s) 88, 96
BssT1I CCWWGG 1 cut(s) 88
Bst2UI CCWGG 1 cut(s) 43
Bst4CI ACNGT 1 cut(s) 119
BstBAI YACGTR 1 cut(s) 73
BstNI CCWGG 1 cut(s) 43
BstSCI CCNGG 3 cut(s) 41, 95, 96
Cfr13I GGNCC 1 cut(s) 76
Cfr9I CCCGGG 1 cut(s) 96
CviJI RGCY 4 cut(s) 26, 41, 49, 93
CviKI_1 RGCY 4 cut(s) 26, 41, 49, 93
Eco130I CCWWGG 1 cut(s) 88
Eco47I GGWCC 1 cut(s) 76
Eco72I CACGTG 1 cut(s) 73
Eco88I CYCGRG 1 cut(s) 96
EcoRI GAATTC 1 cut(s) 154
EcoRII CCWGG 1 cut(s) 41
EcoT14I CCWWGG 1 cut(s) 88
ErhI CCWWGG 1 cut(s) 88
HapII CCGG 1 cut(s) 97
HincII GTYRAC 1 cut(s) 163
HindII GTYRAC 1 cut(s) 163
HindIII AAGCTT 1 cut(s) 47
HinfI GANTC 1 cut(s) 20
HpaII CCGG 1 cut(s) 97
Hpy166II GTNNAC 3 cut(s) 76, 115, 163
Hpy188III TCNNGA 1 cut(s) 34
Hpy8I GTNNAC 3 cut(s) 76, 115, 163
HpyAV CCTTC 1 cut(s) 10
HpyCH4III ACNGT 1 cut(s) 119
HpyCH4IV ACGT 1 cut(s) 72
HpyCH4V TGCA 1 cut(s) 70
HpySE526I ACGT 1 cut(s) 72
LmnI GCTCC 1 cut(s) 98
LpnPI CCDG 3 cut(s) 28, 55, 110
MaeII ACGT 1 cut(s) 72
MboII GAAGA 2 cut(s) 22, 25
MluCI AATT 1 cut(s) 154
MlyI GAGTC 1 cut(s) 14
MmeI TCCRAC 1 cut(s) 82
MnlI CCTC 2 cut(s) 49, 55
MroXI GAANNNNTTC 1 cut(s) 50
MseI TTAA 1 cut(s) 122
MspI CCGG 1 cut(s) 97
MspR9I CCNGG 3 cut(s) 43, 97, 98
MvaI CCWGG 1 cut(s) 43
NciI CCSGG 2 cut(s) 97, 98
NlaIV GGNNCC 2 cut(s) 78, 94
PdmI GAANNNNTTC 1 cut(s) 50
PleI GAGTC 1 cut(s) 14
PmaCI CACGTG 1 cut(s) 73
PmlI CACGTG 1 cut(s) 73
PpsI GAGTC 1 cut(s) 14
Ppu21I YACGTR 1 cut(s) 73
Psp6I CCWGG 1 cut(s) 41
PspCI CACGTG 1 cut(s) 73
PspGI CCWGG 1 cut(s) 41
PspN4I GGNNCC 2 cut(s) 78, 94
PspPI GGNCC 1 cut(s) 76
SaqAI TTAA 1 cut(s) 122
Sau96I GGNCC 1 cut(s) 76
SchI GAGTC 1 cut(s) 14
ScrFI CCNGG 3 cut(s) 43, 97, 98
SetI ASST 4 cut(s) 51, 60, 66, 75
SinI GGWCC 1 cut(s) 76
SmaI CCCGGG 1 cut(s) 98
Sse9I AATT 1 cut(s) 154
SsiI CCGC 2 cut(s) 7, 126
StyD4I CCNGG 3 cut(s) 41, 95, 96
StyI CCWWGG 1 cut(s) 88
TaaI ACNGT 1 cut(s) 119
TaiI ACGT 1 cut(s) 75
TaqI TCGA 2 cut(s) 54, 137
TasI AATT 1 cut(s) 154
Tru1I TTAA 1 cut(s) 122
Tru9I TTAA 1 cut(s) 122
TspMI CCCGGG 1 cut(s) 96
VpaK11BI GGWCC 1 cut(s) 76
XapI RAATTY 1 cut(s) 154
XmaI CCCGGG 1 cut(s) 96
XmnI GAANNNNTTC 1 cut(s) 50
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.