Basic Information

Type: gene

Biological Identity

Species

malus_domestica

Chromosome

Chr03

Orthogroup ID

OG0014703

Physical Location & Seq

Genomic Coordinates Reverse (-)

9484719 .. 9493839

Gene Structure 9121 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

MD03G1108800.v1.1.491

Sequence Viewer

CDS Protein Promoter (2k)

Length: 270 bp

ATGAGGACAAGCGAGGCTTGGGGCCTACGATCCATCGACATATCATCAATCTTTATGAAGAAGCCTGTTCATCCGAATGATCAATCACTGTTTGCTCAAGTTGTTAAGTCTGCACCAGACGCTACAAGAATTCTTCATAAATCGGACAACGAGGGCAAAGTCAAATTCTCAGTTAATGGGAATGATGTTAAAGCTAGGCGATATAAGTCTGTTTATACCATACTTAGGGCCTCCGTATTTAGACCTCGTATAATTACTCGAGGGACTTAA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

90

Amino Acids

10.09

Weight (kDa)

10.76

Isoelectric Point (pI)

32.53

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0014703)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_3g33792
malus_domestica	MD03G1108800.v1.1 MD11G1122600.v1.1
prunus_persica	Prupe.3G138200_v2.0.a1 Prupe.6G092000_v2.0.a1
rosa_laevigata	RLG00000014218 RLG00000035462 RLG00000035472
rosa_multiflora	Rmu_co8089466.1_g000001 Rmu_sc0000338.1_g000001 Rmu_sc0000689.1_g000003
rosa_roxburghii	Rroxscaffold_1G00019350
rosa_rugosa	Rorug05G0339900
rosa_samantha	Rh5AG402100 Rh5BG414300 Rh5CG438900 Rh5DG428900

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AclWI	GGATC	1 cut(s)	24
AcsI	RAATTY	2 cut(s)	129, 164
AfiI	CCNNNNNNNGG	1 cut(s)	225
AluBI	AGCT	1 cut(s)	194
AluI	AGCT	1 cut(s)	194
AlwI	GGATC	1 cut(s)	24
Ama87I	CYCGRG	1 cut(s)	258
AoxI	GGCC	2 cut(s)	22, 228
ApoI	RAATTY	2 cut(s)	129, 164
AspS9I	GGNCC	2 cut(s)	22, 228
AvaI	CYCGRG	1 cut(s)	258
BccI	CCATC	1 cut(s)	41
BclI	TGATCA	1 cut(s)	79
BfaI	CTAG	1 cut(s)	195
BmeT110I	CYCGRG	1 cut(s)	258
BmgT120I	GGNCC	2 cut(s)	22, 228
BmiI	GGNNCC	1 cut(s)	23
BpuEI	CTTGAG	1 cut(s)	81
Bsc4I	CCNNNNNNNGG	1 cut(s)	225
BseGI	GGATG	1 cut(s)	70
BseLI	CCNNNNNNNGG	1 cut(s)	225
BseMII	CTCAG	1 cut(s)	183
BsgI	GTGCAG	1 cut(s)	96
BshFI	GGCC	2 cut(s)	24, 230
BsiHKCI	CYCGRG	1 cut(s)	258
BslI	CCNNNNNNNGG	1 cut(s)	225
BsnI	GGCC	2 cut(s)	24, 230
BsoBI	CYCGRG	1 cut(s)	258
Bsp143I	GATC	2 cut(s)	29, 79
BspANI	GGCC	2 cut(s)	24, 230
BspCNI	CTCAG	1 cut(s)	182
BspLI	GGNNCC	1 cut(s)	23
BspPI	GGATC	1 cut(s)	24
BssMI	GATC	2 cut(s)	29, 79
Bst4CI	ACNGT	1 cut(s)	90
BstDEI	CTNAG	2 cut(s)	169, 224
BstF5I	GGATG	1 cut(s)	70
BstKTI	GATC	2 cut(s)	32, 82
BstMBI	GATC	2 cut(s)	29, 79
BstMWI	GCNNNNNNNGC	1 cut(s)	119
BsuRI	GGCC	2 cut(s)	24, 230
BtsCI	GGATG	1 cut(s)	70
BtsIMutI	CAGTG	1 cut(s)	86
Cfr13I	GGNCC	2 cut(s)	22, 228
CseI	GACGC	1 cut(s)	128
CviJI	RGCY	5 cut(s)	17, 24, 64, 194, 230
CviKI_1	RGCY	5 cut(s)	17, 24, 64, 194, 230
DdeI	CTNAG	2 cut(s)	169, 224
DpnI	GATC	2 cut(s)	31, 81
DpnII	GATC	2 cut(s)	29, 79
Eco88I	CYCGRG	1 cut(s)	258
EcoO109I	RGGNCCY	2 cut(s)	22, 228
EcoRI	GAATTC	1 cut(s)	129
FaiI	YATR	7 cut(s)	41, 56, 138, 204, 216, 221, 251
FalI	AAGNNNNNCTT	1 cut(s)	33
FbaI	TGATCA	1 cut(s)	79
FokI	GGATG	1 cut(s)	57
FspBI	CTAG	1 cut(s)	195
HaeIII	GGCC	2 cut(s)	24, 230
HgaI	GACGC	1 cut(s)	128
Hpy188I	TCNGA	2 cut(s)	75, 145
HpyCH4III	ACNGT	1 cut(s)	90
HpyCH4V	TGCA	1 cut(s)	113
HpyF10VI	GCNNNNNNNGC	1 cut(s)	119
HpyF3I	CTNAG	2 cut(s)	169, 224
Ksp22I	TGATCA	1 cut(s)	79
Kzo9I	GATC	2 cut(s)	29, 79
LpnPI	CCDG	2 cut(s)	78, 129
MaeI	CTAG	1 cut(s)	195
MalI	GATC	2 cut(s)	31, 81
MboI	GATC	2 cut(s)	29, 79
MboII	GAAGA	2 cut(s)	70, 125
MluCI	AATT	3 cut(s)	129, 164, 252
MnlI	CCTC	5 cut(s)	7, 145, 241, 254, 255
MseI	TTAA	4 cut(s)	105, 174, 189, 268
MslI	CAYNNNNRTG	1 cut(s)	75
MwoI	GCNNNNNNNGC	1 cut(s)	119
NdeII	GATC	2 cut(s)	29, 79
NlaIV	GGNNCC	1 cut(s)	23
PaeR7I	CTCGAG	1 cut(s)	258
PspN4I	GGNNCC	1 cut(s)	23
PspPI	GGNCC	2 cut(s)	22, 228
PspXI	VCTCGAGB	1 cut(s)	258
RseI	CAYNNNNRTG	1 cut(s)	75
SaqAI	TTAA	4 cut(s)	105, 174, 189, 268
Sau3AI	GATC	2 cut(s)	29, 79
Sau96I	GGNCC	2 cut(s)	22, 228
SetI	ASST	2 cut(s)	196, 247
Sfr274I	CTCGAG	1 cut(s)	258
SlaI	CTCGAG	1 cut(s)	258
SmiMI	CAYNNNNRTG	1 cut(s)	75
SmlI	CTYRAG	2 cut(s)	96, 258
SmoI	CTYRAG	2 cut(s)	96, 258
Sse9I	AATT	3 cut(s)	129, 164, 252
SspMI	CTAG	1 cut(s)	195
TaaI	ACNGT	1 cut(s)	90
TaqI	TCGA	2 cut(s)	36, 259
TasI	AATT	3 cut(s)	129, 164, 252
Tru1I	TTAA	4 cut(s)	105, 174, 189, 268
Tru9I	TTAA	4 cut(s)	105, 174, 189, 268
TscAI	CASTG	1 cut(s)	93
TspDTI	ATGAA	3 cut(s)	59, 71, 125
TspGWI	ACGGA	1 cut(s)	223
TspRI	CASTG	1 cut(s)	93
XapI	RAATTY	2 cut(s)	129, 164
XhoI	CTCGAG	1 cut(s)	258
XspI	CTAG	1 cut(s)	195

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.