MD05G1057700.v1.1

CRS1_YhbY

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr05
OG0010962
Physical Location & Seq
Reverse (-)
10031664 .. 10033602
1939 bp
Loading structure...
UTR
Exon/CDS
Intron
MD05G1057700.v1.1.491

Sequence Viewer

Length: 144 bp
ATGAGCTTCGCAAGTCTGAAATTGGTGAAAATTCACGGGACATGTCCTGGTGAGCTAGAGGATGTCGGTACACAATTGGAGGAATCAACTGGTTCAGTTGTGACGAAAGACATAATCGAGACCCACATCGATGGAATACCGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
CRS1_YhbY

Protein Analysis

48

Amino Acids

5.0

Weight (kDa)

4.54

Isoelectric Point (pI)

36.79

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0010962)

Species Orthologous Gene IDs
arabidopsis_thaliana AT2G21350 AT4G39040 AT4G39040
fragaria_vesca FvH4_2g10110
malus_domestica MD05G1057700.v1.1 MD10G1065400.v1.1
prunus_persica Prupe.8G087400_v2.0.a1
pyrus_communis pycom05g04880
rosa_chinensis RchiOBHm_Chr6g0267071
rosa_laevigata RLG00000014044
rosa_multiflora Rmu_co8165610.1_g000001 Rmu_sc0002938.1_g000055 Rmu_ssc0000388.1_g000005
rosa_roxburghii Rroxscaffold_7G00201170
rosa_rugosa Rorug06G0028900
rosa_samantha Rh6AG150500 Rh6BG151300 Rh6CG146700 Rh6DG135400
rosa_wichuraiana Rw6G013040

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 30
AfaI GTAC 1 cut(s) 70
AflIII ACRYGT 1 cut(s) 41
AjnI CCWGG 1 cut(s) 46
AluBI AGCT 2 cut(s) 6, 55
AluI AGCT 2 cut(s) 6, 55
Alw26I GTCTC 1 cut(s) 113
ApoI RAATTY 1 cut(s) 30
AsuHPI GGTGA 2 cut(s) 37, 62
BccI CCATC 1 cut(s) 125
BciT130I CCWGG 1 cut(s) 48
BcoDI GTCTC 1 cut(s) 113
BfaI CTAG 1 cut(s) 56
Bme1390I CCNGG 1 cut(s) 48
BmrFI CCNGG 1 cut(s) 48
Bsa29I ATCGAT 1 cut(s) 129
BsaI GGTCTC 1 cut(s) 113
Bse1I ACTGG 1 cut(s) 94
BseBI CCWGG 1 cut(s) 48
BseCI ATCGAT 1 cut(s) 129
BseGI GGATG 1 cut(s) 67
BseNI ACTGG 1 cut(s) 94
BshVI ATCGAT 1 cut(s) 129
BslFI GGGAC 1 cut(s) 52
BsmAI GTCTC 1 cut(s) 113
BsmFI GGGAC 1 cut(s) 52
Bso31I GGTCTC 1 cut(s) 113
BspDI ATCGAT 1 cut(s) 129
BspTNI GGTCTC 1 cut(s) 113
BsrI ACTGG 1 cut(s) 94
Bst2UI CCWGG 1 cut(s) 48
Bst4CI ACNGT 1 cut(s) 141
BstF5I GGATG 1 cut(s) 67
BstMAI GTCTC 1 cut(s) 113
BstNI CCWGG 1 cut(s) 48
BstNSI RCATGY 1 cut(s) 45
BstSCI CCNGG 1 cut(s) 46
BstXI CCANNNNNNTGG 1 cut(s) 131
Bsu15I ATCGAT 1 cut(s) 129
BsuTUI ATCGAT 1 cut(s) 129
BtsCI GGATG 1 cut(s) 67
ClaI ATCGAT 1 cut(s) 129
Csp6I GTAC 1 cut(s) 69
CviAII CATG 1 cut(s) 42
CviJI RGCY 2 cut(s) 6, 55
CviKI_1 RGCY 2 cut(s) 6, 55
CviQI GTAC 1 cut(s) 69
Eco31I GGTCTC 1 cut(s) 113
EcoRII CCWGG 1 cut(s) 46
FaeI CATG 1 cut(s) 45
FaiI YATR 2 cut(s) 43, 113
FaqI GGGAC 1 cut(s) 52
FatI CATG 1 cut(s) 41
FokI GGATG 1 cut(s) 74
FspBI CTAG 1 cut(s) 56
Hin1II CATG 1 cut(s) 45
HinfI GANTC 1 cut(s) 83
HphI GGTGA 2 cut(s) 37, 62
Hpy166II GTNNAC 1 cut(s) 71
Hpy188I TCNGA 1 cut(s) 18
Hpy188III TCNNGA 1 cut(s) 118
Hpy8I GTNNAC 1 cut(s) 71
HpyCH4III ACNGT 1 cut(s) 141
Hsp92II CATG 1 cut(s) 45
LpnPI CCDG 3 cut(s) 33, 60, 75
MaeI CTAG 1 cut(s) 56
MaeIII GTNAC 1 cut(s) 100
MfeI CAATTG 1 cut(s) 74
MluCI AATT 3 cut(s) 20, 30, 74
MnlI CCTC 2 cut(s) 52, 73
MslI CAYNNNNRTG 1 cut(s) 129
MspR9I CCNGG 1 cut(s) 48
MunI CAATTG 1 cut(s) 74
MvaI CCWGG 1 cut(s) 48
NlaIII CATG 1 cut(s) 45
NmuCI GTSAC 1 cut(s) 100
NspI RCATGY 1 cut(s) 45
PciI ACATGT 1 cut(s) 41
PfeI GAWTC 1 cut(s) 83
PscI ACATGT 1 cut(s) 41
Psp6I CCWGG 1 cut(s) 46
PspGI CCWGG 1 cut(s) 46
RsaI GTAC 1 cut(s) 70
RsaNI GTAC 1 cut(s) 69
RseI CAYNNNNRTG 1 cut(s) 129
ScrFI CCNGG 1 cut(s) 48
SetI ASST 2 cut(s) 8, 57
SgeI CNNG 9 cut(s) 24, 47, 49, 54, 59, 60, 68, 102, 130
SmiMI CAYNNNNRTG 1 cut(s) 129
Sse9I AATT 3 cut(s) 20, 30, 74
SspMI CTAG 1 cut(s) 56
StyD4I CCNGG 1 cut(s) 46
TaaI ACNGT 1 cut(s) 141
TaqI TCGA 2 cut(s) 117, 129
TasI AATT 3 cut(s) 20, 30, 74
TfiI GAWTC 1 cut(s) 83
TseFI GTSAC 1 cut(s) 100
Tsp45I GTSAC 1 cut(s) 100
XapI RAATTY 1 cut(s) 30
XceI RCATGY 1 cut(s) 45
XspI CTAG 1 cut(s) 56
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.