Rmu_co8165610.1_g000001

CRS1_YhbY

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_co8165610.1
OG0010962
Physical Location & Seq
Forward (+)
1 .. 290
290 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_co8165610.1_g000001.1.cds

Sequence Viewer

Length: 290 bp
aatgtggtgaacaggttaaaatacatgggacatgtccagaggagctagatgatacggtgaagcaattggaggctgcaactggttcagttgttgtcggtcggattggtagaacagtgattctttacaggccaagtctcaccaagctgaaagctgaggagaaaaaagagcagatgcggaagatttttttgaagcgaaagcagagatattcacgaccatcatctatggaatttcagaaaaaaggaagaccgaggatgtttgtgcgtgacagccgtggaagacccaaggtctag
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
CRS1_YhbY

Protein Analysis

95

Amino Acids

11.0

Weight (kDa)

10.37

Isoelectric Point (pI)

37.82

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0010962)

Species Orthologous Gene IDs
arabidopsis_thaliana AT2G21350 AT4G39040 AT4G39040
fragaria_vesca FvH4_2g10110
malus_domestica MD05G1057700.v1.1 MD10G1065400.v1.1
prunus_persica Prupe.8G087400_v2.0.a1
pyrus_communis pycom05g04880
rosa_chinensis RchiOBHm_Chr6g0267071
rosa_laevigata RLG00000014044
rosa_multiflora Rmu_co8165610.1_g000001 Rmu_sc0002938.1_g000055 Rmu_ssc0000388.1_g000005
rosa_roxburghii Rroxscaffold_7G00201170
rosa_rugosa Rorug06G0028900
rosa_samantha Rh6AG150500 Rh6BG151300 Rh6CG146700 Rh6DG135400
rosa_wichuraiana Rw6G013040

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 174
AcsI RAATTY 1 cut(s) 226
AflIII ACRYGT 1 cut(s) 31
AgsI TTSAA 1 cut(s) 189
AhdI GACNNNNNGTC 1 cut(s) 283
AluBI AGCT 3 cut(s) 45, 144, 151
AluI AGCT 3 cut(s) 45, 144, 151
Alw26I GTCTC 1 cut(s) 139
AoxI GGCC 1 cut(s) 127
ApeKI GCWGC 1 cut(s) 73
ApoI RAATTY 1 cut(s) 226
AsuHPI GGTGA 3 cut(s) 19, 69, 129
BbsI GAAGAC 2 cut(s) 249, 282
BbvCI CCTCAGC 1 cut(s) 152
BbvI GCAGC 1 cut(s) 60
BccI CCATC 1 cut(s) 222
BceAI ACGGC 1 cut(s) 254
BcoDI GTCTC 1 cut(s) 139
BfaI CTAG 2 cut(s) 46, 288
BisI GCNGC 1 cut(s) 74
BlsI GCNGC 1 cut(s) 75
BmeRI GACNNNNNGTC 1 cut(s) 283
BmsI GCATC 1 cut(s) 161
BpiI GAAGAC 2 cut(s) 249, 282
Bpu10I CCTNAGC 1 cut(s) 152
BsaJI CCNNGG 3 cut(s) 247, 270, 281
Bse1I ACTGG 1 cut(s) 84
BseDI CCNNGG 3 cut(s) 247, 270, 281
BseGI GGATG 1 cut(s) 257
BseMII CTCAG 1 cut(s) 143
BseNI ACTGG 1 cut(s) 84
BseRI GAGGAG 2 cut(s) 55, 169
BseXI GCAGC 1 cut(s) 60
Bsh1285I CGRYCG 1 cut(s) 99
BshFI GGCC 1 cut(s) 129
BsiEI CGRYCG 1 cut(s) 99
BslFI GGGAC 1 cut(s) 42
BsmAI GTCTC 1 cut(s) 139
BsmFI GGGAC 1 cut(s) 42
BsnI GGCC 1 cut(s) 129
BspACI CCGC 1 cut(s) 174
BspANI GGCC 1 cut(s) 129
BspCNI CTCAG 1 cut(s) 144
BsrI ACTGG 1 cut(s) 84
BssECI CCNNGG 3 cut(s) 247, 270, 281
BssT1I CCWWGG 1 cut(s) 281
Bst4CI ACNGT 2 cut(s) 57, 114
BstDEI CTNAG 1 cut(s) 152
BstDSI CCRYGG 1 cut(s) 270
BstF5I GGATG 1 cut(s) 257
BstMAI GTCTC 1 cut(s) 139
BstMCI CGRYCG 1 cut(s) 99
BstNSI RCATGY 1 cut(s) 35
BstV1I GCAGC 1 cut(s) 60
BstV2I GAAGAC 2 cut(s) 249, 282
BsuRI GGCC 1 cut(s) 129
BtgI CCRYGG 1 cut(s) 270
BtsCI GGATG 1 cut(s) 257
BtsIMutI CAGTG 1 cut(s) 119
CviAII CATG 2 cut(s) 25, 32
CviJI RGCY 6 cut(s) 45, 73, 129, 144, 151, 269
CviKI_1 RGCY 6 cut(s) 45, 73, 129, 144, 151, 269
DdeI CTNAG 1 cut(s) 152
DriI GACNNNNNGTC 1 cut(s) 283
Eam1105I GACNNNNNGTC 1 cut(s) 283
Eco130I CCWWGG 1 cut(s) 281
EcoT14I CCWWGG 1 cut(s) 281
ErhI CCWWGG 1 cut(s) 281
FaeI CATG 2 cut(s) 28, 35
FaiI YATR 3 cut(s) 26, 33, 223
FaqI GGGAC 1 cut(s) 42
FatI CATG 2 cut(s) 24, 31
Fnu4HI GCNGC 1 cut(s) 74
FokI GGATG 1 cut(s) 264
Fsp4HI GCNGC 1 cut(s) 74
FspBI CTAG 2 cut(s) 46, 288
GluI GCNGC 1 cut(s) 74
HaeIII GGCC 1 cut(s) 129
Hin1II CATG 2 cut(s) 28, 35
HinfI GANTC 1 cut(s) 117
HphI GGTGA 3 cut(s) 19, 69, 129
Hpy166II GTNNAC 1 cut(s) 10
Hpy188I TCNGA 2 cut(s) 101, 233
Hpy188III TCNNGA 2 cut(s) 37, 209
Hpy8I GTNNAC 1 cut(s) 10
HpyCH4III ACNGT 2 cut(s) 57, 114
HpyCH4V TGCA 1 cut(s) 76
HpyF3I CTNAG 1 cut(s) 152
Hsp92II CATG 2 cut(s) 28, 35
LmnI GCTCC 1 cut(s) 42
LpnPI CCDG 3 cut(s) 50, 65, 111
Lsp1109I GCAGC 1 cut(s) 60
LweI GCATC 1 cut(s) 161
MaeI CTAG 2 cut(s) 46, 288
MaeIII GTNAC 1 cut(s) 262
MboII GAAGA 3 cut(s) 189, 254, 287
MfeI CAATTG 1 cut(s) 64
MluCI AATT 2 cut(s) 64, 226
MmeI TCCRAC 1 cut(s) 79
MnlI CCTC 4 cut(s) 33, 63, 147, 242
MseI TTAA 1 cut(s) 17
MunI CAATTG 1 cut(s) 64
NlaIII CATG 2 cut(s) 28, 35
NmuCI GTSAC 1 cut(s) 262
NspI RCATGY 1 cut(s) 35
PciI ACATGT 1 cut(s) 31
PfeI GAWTC 1 cut(s) 117
PkrI GCNGC 1 cut(s) 75
PscI ACATGT 1 cut(s) 31
SaqAI TTAA 1 cut(s) 17
SatI GCNGC 1 cut(s) 74
SetI ASST 5 cut(s) 17, 47, 146, 153, 287
SfaNI GCATC 1 cut(s) 161
Sse9I AATT 2 cut(s) 64, 226
SsiI CCGC 1 cut(s) 174
SspMI CTAG 2 cut(s) 46, 288
StyI CCWWGG 1 cut(s) 281
TaaI ACNGT 2 cut(s) 57, 114
TaqII GACCGA 2 cut(s) 85, 261
TasI AATT 2 cut(s) 64, 226
TfiI GAWTC 1 cut(s) 117
Tru1I TTAA 1 cut(s) 17
Tru9I TTAA 1 cut(s) 17
TscAI CASTG 1 cut(s) 119
TseFI GTSAC 1 cut(s) 262
TseI GCWGC 1 cut(s) 73
Tsp45I GTSAC 1 cut(s) 262
TspRI CASTG 1 cut(s) 119
XapI RAATTY 1 cut(s) 226
XceI RCATGY 1 cut(s) 35
XspI CTAG 2 cut(s) 46, 288
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.