MD05G1301700.v1.1

Protein of unknown function, DUF538

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr05
Physical Location & Seq
Reverse (-)
43440133 .. 43440540
408 bp
Loading structure...
UTR
Exon/CDS
Intron
MD05G1301700.v1.1.491

Sequence Viewer

Length: 408 bp
ATGGCAGAGAAGGAAGGAGGAATCGTGAAGAAGGGCCATGAAGAGGGGCTGGCATTGGCGACCGCCTTGCTCCAAGAGTTCGGACTTCCGCTAGGGCTTTTGCCTCTTGCTGATGTGATCGAAGTTGGCTTTGTGAGAGCCACCGGCTACATGTGGATCGTCCAGAAGAAGAAGGTCGAACACAACTTCAAGTTGATTAGTAAGCTTGTGAGTTATGACACCGAAATCAAGGGCTATATTGAGAAGCAGAAGATTAAGAAGCTCAAGGGAGTGAAGGCTAAGGAGCTCATGCTGTGGCCTCCGGTTAGTGAAATAAACGTTGATCAGCCTGCGGGAAAAATCAACTTCAAGAGCCTTGCCGGTATCACTAAGACTTTCCCGGTCGAGGCATTTTCTGCCGGGCAGTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families

Protein Analysis

136

Amino Acids

14.87

Weight (kDa)

9.35

Isoelectric Point (pI)

31.32

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
DUF538 PF04398 21 - 131 4.4e-34 Protein of unknown function, DUF538
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 3 cut(s) 63, 89, 332
AclI AACGTT 1 cut(s) 318
AclWI GGATC 1 cut(s) 164
AfiI CCNNNNNNNGG 2 cut(s) 43, 385
AflIII ACRYGT 1 cut(s) 150
AgsI TTSAA 2 cut(s) 190, 349
AluBI AGCT 3 cut(s) 205, 262, 286
AluI AGCT 3 cut(s) 205, 262, 286
Alw21I GWGCWC 1 cut(s) 288
AlwI GGATC 1 cut(s) 164
AoxI GGCC 2 cut(s) 34, 296
AspS9I GGNCC 1 cut(s) 34
AsuC2I CCSGG 2 cut(s) 380, 400
BanII GRGCYC 1 cut(s) 288
Bbv12I GWGCWC 1 cut(s) 288
BcgI CGANNNNNNTGC 2 cut(s) 49, 83
BclI TGATCA 1 cut(s) 322
BcnI CCSGG 2 cut(s) 380, 400
BfaI CTAG 1 cut(s) 92
Bme1390I CCNGG 2 cut(s) 380, 400
BmgT120I GGNCC 1 cut(s) 34
BmrFI CCNGG 2 cut(s) 380, 400
Bpu10I CCTNAGC 1 cut(s) 279
BpuEI CTTGAG 1 cut(s) 248
BpuMI CCSGG 2 cut(s) 380, 400
BsaWI WCCGGW 1 cut(s) 301
BsaXI ACNNNNNCTCC 2 cut(s) 9, 39
Bsc4I CCNNNNNNNGG 2 cut(s) 43, 385
Bse118I RCCGGY 2 cut(s) 143, 359
BseLI CCNNNNNNNGG 2 cut(s) 43, 385
Bsh1285I CGRYCG 2 cut(s) 63, 384
BshFI GGCC 2 cut(s) 36, 298
BsiEI CGRYCG 2 cut(s) 63, 384
BsiHKAI GWGCWC 1 cut(s) 288
BsiSI CCGG 5 cut(s) 144, 302, 360, 380, 399
BslI CCNNNNNNNGG 2 cut(s) 43, 385
BsnI GGCC 2 cut(s) 36, 298
Bsp1286I GDGCHC 1 cut(s) 288
Bsp143I GATC 3 cut(s) 117, 156, 322
BspACI CCGC 3 cut(s) 63, 89, 332
BspANI GGCC 2 cut(s) 36, 298
BspPI GGATC 1 cut(s) 164
BsrFI RCCGGY 2 cut(s) 143, 359
BssAI RCCGGY 2 cut(s) 143, 359
BssMI GATC 3 cut(s) 117, 156, 322
Bst6I CTCTTC 1 cut(s) 36
BstAPI GCANNNNNTGC 1 cut(s) 395
BstC8I GCNNGC 2 cut(s) 51, 330
BstDEI CTNAG 2 cut(s) 279, 369
BstKTI GATC 3 cut(s) 120, 159, 325
BstMBI GATC 3 cut(s) 117, 156, 322
BstMCI CGRYCG 2 cut(s) 63, 384
BstMWI GCNNNNNNNGC 1 cut(s) 395
BstNSI RCATGY 1 cut(s) 154
BstSCI CCNGG 2 cut(s) 378, 398
BsuRI GGCC 2 cut(s) 36, 298
Cac8I GCNNGC 2 cut(s) 51, 330
Cfr10I RCCGGY 2 cut(s) 143, 359
Cfr13I GGNCC 1 cut(s) 34
CviAII CATG 3 cut(s) 38, 151, 289
DdeI CTNAG 2 cut(s) 279, 369
DpnI GATC 3 cut(s) 119, 158, 324
DpnII GATC 3 cut(s) 117, 156, 322
Eam1104I CTCTTC 1 cut(s) 36
EarI CTCTTC 1 cut(s) 36
Ecl136II GAGCTC 1 cut(s) 286
Eco24I GRGCYC 1 cut(s) 288
Eco53kI GAGCTC 1 cut(s) 286
EcoICRI GAGCTC 1 cut(s) 286
EcoT38I GRGCYC 1 cut(s) 288
FaeI CATG 3 cut(s) 41, 154, 292
FaiI YATR 5 cut(s) 39, 152, 216, 237, 290
FatI CATG 3 cut(s) 37, 150, 288
FauI CCCGC 1 cut(s) 325
FbaI TGATCA 1 cut(s) 322
FriOI GRGCYC 1 cut(s) 288
FspBI CTAG 1 cut(s) 92
HaeIII GGCC 2 cut(s) 36, 298
HapII CCGG 5 cut(s) 144, 302, 360, 380, 399
Hin1II CATG 3 cut(s) 41, 154, 292
HindIII AAGCTT 1 cut(s) 203
HinfI GANTC 1 cut(s) 21
HpaII CCGG 5 cut(s) 144, 302, 360, 380, 399
Hpy188I TCNGA 1 cut(s) 83
Hpy188III TCNNGA 3 cut(s) 25, 163, 349
HpyAV CCTTC 5 cut(s) 4, 8, 25, 166, 268
HpyCH4IV ACGT 1 cut(s) 318
HpyF10VI GCNNNNNNNGC 1 cut(s) 395
HpyF3I CTNAG 2 cut(s) 279, 369
HpySE526I ACGT 1 cut(s) 318
Hsp92II CATG 3 cut(s) 41, 154, 292
Ksp22I TGATCA 1 cut(s) 322
Kzo9I GATC 3 cut(s) 117, 156, 322
LmnI GCTCC 2 cut(s) 75, 283
LpnPI CCDG 7 cut(s) 35, 157, 176, 315, 342, 373, 393
MaeI CTAG 1 cut(s) 92
MaeII ACGT 1 cut(s) 318
MalI GATC 3 cut(s) 119, 158, 324
MboI GATC 3 cut(s) 117, 156, 322
MboII GAAGA 5 cut(s) 40, 53, 178, 181, 262
MhlI GDGCHC 1 cut(s) 288
MnlI CCTC 5 cut(s) 11, 37, 114, 309, 379
MseI TTAA 1 cut(s) 255
MspI CCGG 5 cut(s) 144, 302, 360, 380, 399
MspR9I CCNGG 2 cut(s) 380, 400
MwoI GCNNNNNNNGC 1 cut(s) 395
NciI CCSGG 2 cut(s) 380, 400
NdeII GATC 3 cut(s) 117, 156, 322
NlaIII CATG 3 cut(s) 41, 154, 292
NspI RCATGY 1 cut(s) 154
PciI ACATGT 1 cut(s) 150
PfeI GAWTC 1 cut(s) 21
PscI ACATGT 1 cut(s) 150
Psp124BI GAGCTC 1 cut(s) 288
Psp1406I AACGTT 1 cut(s) 318
PspPI GGNCC 1 cut(s) 34
SacI GAGCTC 1 cut(s) 288
SaqAI TTAA 1 cut(s) 255
Sau3AI GATC 3 cut(s) 117, 156, 322
Sau96I GGNCC 1 cut(s) 34
ScrFI CCNGG 2 cut(s) 380, 400
SduI GDGCHC 1 cut(s) 288
SetI ASST 5 cut(s) 177, 207, 264, 288, 321
SmlI CTYRAG 1 cut(s) 263
SmoI CTYRAG 1 cut(s) 263
SsiI CCGC 3 cut(s) 63, 89, 332
SspMI CTAG 1 cut(s) 92
SstI GAGCTC 1 cut(s) 288
StyD4I CCNGG 2 cut(s) 378, 398
TaiI ACGT 1 cut(s) 321
TaqI TCGA 3 cut(s) 120, 177, 384
TfiI GAWTC 1 cut(s) 21
Tru1I TTAA 1 cut(s) 255
Tru9I TTAA 1 cut(s) 255
TspDTI ATGAA 1 cut(s) 54
XceI RCATGY 1 cut(s) 154
XspI CTAG 1 cut(s) 92
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.