MD06G1136800.v1.1

May serve as docking site to facilitate the association of other proteins to the plasma membrane

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr06
OG0009060
Physical Location & Seq
Forward (+)
28185808 .. 28187890
2083 bp
Loading structure...
UTR
Exon/CDS
Intron
MD06G1136800.v1.1.491

Sequence Viewer

Length: 357 bp
ATGCCGGAGGACGATTTGGTGGACATAAAGTTCCGGTTGTACGACGGCACCGATGTCGGTCCGTTCAGCTACTCATCGGCCTCAACCGTCGATATGCTCAAGCAGAGGGTCGTCTCTGATTGGCCCAAAGGCAAGACTATGACGCCGAAGACGGCGAATGAAGTGAAACTGATGAGTTTTGGCAAGATTTTGGAGAACAACAAGACAGTGGGTCAGTGTAAATTACCTTTGGCTGATATTGGTGGGGGAATTATCGTAATGCATGTTGTTGTACAGCCAGCTATCGAAAAAGCTAAAACGGAAAAGAAGATTGATGATCTGCCCCAGAAAGTTGTCTGCTCATGTTCCATATTATGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0005575 GO:0005623 GO:0005886 GO:0016020 GO:0044464 GO:0071944
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Rad60-SLD_2

Protein Analysis

119

Amino Acids

12.94

Weight (kDa)

7.66

Isoelectric Point (pI)

41.05

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Rad60-SLD_2 PF13881 5 - 116 1.3e-39 Ubiquitin-2 like Rad60 SUMO-like
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 47
AcyI GRCGYC 1 cut(s) 143
AfaI GTAC 2 cut(s) 41, 273
AhdI GACNNNNNGTC 1 cut(s) 210
AloI GAACNNNNNNTCC 2 cut(s) 14, 46
AluBI AGCT 3 cut(s) 69, 281, 293
AluI AGCT 3 cut(s) 69, 281, 293
Alw26I GTCTC 1 cut(s) 118
AoxI GGCC 2 cut(s) 78, 122
AspS9I GGNCC 2 cut(s) 59, 123
AvaII GGWCC 1 cut(s) 59
BanI GGYRCC 1 cut(s) 47
BbsI GAAGAC 1 cut(s) 155
BceAI ACGGC 2 cut(s) 61, 168
BcgI CGANNNNNNTGC 2 cut(s) 37, 71
BcoDI GTCTC 1 cut(s) 118
Bme18I GGWCC 1 cut(s) 59
BmeRI GACNNNNNGTC 1 cut(s) 210
BmgT120I GGNCC 2 cut(s) 59, 123
BmiI GGNNCC 1 cut(s) 49
BpiI GAAGAC 1 cut(s) 155
BpuEI CTTGAG 1 cut(s) 83
BsaHI GRCGYC 1 cut(s) 143
BsaWI WCCGGW 1 cut(s) 33
BshFI GGCC 2 cut(s) 80, 124
BshNI GGYRCC 1 cut(s) 47
BsiSI CCGG 2 cut(s) 5, 34
BsmAI GTCTC 1 cut(s) 118
BsmBI CGTCTC 1 cut(s) 118
BsnI GGCC 2 cut(s) 80, 124
Bsp1407I TGTACA 1 cut(s) 271
Bsp143I GATC 1 cut(s) 316
BspANI GGCC 2 cut(s) 80, 124
BspLI GGNNCC 1 cut(s) 49
BspT107I GGYRCC 1 cut(s) 47
BsrGI TGTACA 1 cut(s) 271
BssMI GATC 1 cut(s) 316
BssNI GRCGYC 1 cut(s) 143
Bst4CI ACNGT 2 cut(s) 88, 208
BstACI GRCGYC 1 cut(s) 143
BstAUI TGTACA 1 cut(s) 271
BstC8I GCNNGC 1 cut(s) 279
BstKTI GATC 1 cut(s) 319
BstMAI GTCTC 1 cut(s) 118
BstMBI GATC 1 cut(s) 316
BstNSI RCATGY 1 cut(s) 266
BstV2I GAAGAC 1 cut(s) 155
BsuRI GGCC 2 cut(s) 80, 124
BtsIMutI CAGTG 2 cut(s) 213, 221
Cac8I GCNNGC 1 cut(s) 279
Cfr13I GGNCC 2 cut(s) 59, 123
CpoI CGGWCCG 1 cut(s) 59
CseI GACGC 1 cut(s) 151
Csp6I GTAC 2 cut(s) 40, 272
CspI CGGWCCG 1 cut(s) 59
CviAII CATG 2 cut(s) 263, 342
CviJI RGCY 7 cut(s) 69, 80, 124, 233, 277, 281, 293
CviKI_1 RGCY 7 cut(s) 69, 80, 124, 233, 277, 281, 293
CviQI GTAC 2 cut(s) 40, 272
DpnI GATC 1 cut(s) 318
DpnII GATC 1 cut(s) 316
DriI GACNNNNNGTC 1 cut(s) 210
Eam1105I GACNNNNNGTC 1 cut(s) 210
Eco47I GGWCC 1 cut(s) 59
EcoT22I ATGCAT 1 cut(s) 264
Esp3I CGTCTC 1 cut(s) 118
FaeI CATG 2 cut(s) 266, 345
FaiI YATR 7 cut(s) 26, 95, 140, 264, 343, 350, 355
FatI CATG 2 cut(s) 262, 341
HaeIII GGCC 2 cut(s) 80, 124
HapII CCGG 2 cut(s) 5, 34
HgaI GACGC 1 cut(s) 151
Hin1I GRCGYC 1 cut(s) 143
Hin1II CATG 2 cut(s) 266, 345
HpaII CCGG 2 cut(s) 5, 34
Hpy166II GTNNAC 1 cut(s) 22
Hpy188I TCNGA 1 cut(s) 118
Hpy8I GTNNAC 1 cut(s) 22
Hpy99I CGWCG 2 cut(s) 47, 92
HpyCH4III ACNGT 2 cut(s) 88, 208
HpyCH4V TGCA 1 cut(s) 262
Hsp92I GRCGYC 1 cut(s) 143
Hsp92II CATG 2 cut(s) 266, 345
Kzo9I GATC 1 cut(s) 316
LpnPI CCDG 4 cut(s) 18, 47, 291, 338
MalI GATC 1 cut(s) 318
MboI GATC 1 cut(s) 316
MboII GAAGA 2 cut(s) 160, 319
MluCI AATT 2 cut(s) 221, 249
MnlI CCTC 2 cut(s) 91, 99
Mph1103I ATGCAT 1 cut(s) 264
MspI CCGG 2 cut(s) 5, 34
NdeII GATC 1 cut(s) 316
NlaIII CATG 2 cut(s) 266, 345
NlaIV GGNNCC 1 cut(s) 49
NsiI ATGCAT 1 cut(s) 264
NspI RCATGY 1 cut(s) 266
PcsI WCGNNNNNNNCGW 1 cut(s) 48
PspN4I GGNNCC 1 cut(s) 49
PspPI GGNCC 2 cut(s) 59, 123
RsaI GTAC 2 cut(s) 41, 273
RsaNI GTAC 2 cut(s) 40, 272
Rsr2I CGGWCCG 1 cut(s) 59
RsrII CGGWCCG 1 cut(s) 59
Sau3AI GATC 1 cut(s) 316
Sau96I GGNCC 2 cut(s) 59, 123
SetI ASST 4 cut(s) 71, 229, 283, 295
SgeI CNNG 9 cut(s) 17, 46, 112, 145, 196, 214, 275, 290, 337
SinI GGWCC 1 cut(s) 59
SmlI CTYRAG 1 cut(s) 98
SmoI CTYRAG 1 cut(s) 98
Sse9I AATT 2 cut(s) 221, 249
TaaI ACNGT 2 cut(s) 88, 208
TaqI TCGA 2 cut(s) 90, 285
TaqII GACCGA 1 cut(s) 47
TasI AATT 2 cut(s) 221, 249
TatI WGTACW 1 cut(s) 271
TscAI CASTG 2 cut(s) 213, 221
TspDTI ATGAA 1 cut(s) 174
TspGWI ACGGA 2 cut(s) 51, 314
TspRI CASTG 2 cut(s) 213, 221
VpaK11BI GGWCC 1 cut(s) 59
XceI RCATGY 1 cut(s) 266
Zsp2I ATGCAT 1 cut(s) 264
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.