Basic Information

Type: gene

Biological Identity

Species

rosa_samantha

Chromosome

Chr7D

Orthogroup ID

OG0009060

Physical Location & Seq

Genomic Coordinates Forward (+)

8858617 .. 8859664

Gene Structure 1048 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rh7DG104100.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 186 bp

ATGCCGGAGGAGGATTTGGTGGACATAAAGTTCAGGCTGTACGATGGCTCTGATATAGGGCCGTTCAGCTACTCATCAGCCTCCACAGTCGATATGCTTAAGCAGAGGGTCGTCTCCGACTGGCCCAAAGGTATCTTTGCCCTTTCAACAAATCTTGTAAATAAGAGTTATTATGCTAATGTGTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005623 GO:0005886 GO:0016020 GO:0044464 GO:0071944

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

Rad60-SLD_2

Protein Analysis

61

Amino Acids

6.88

Weight (kDa)

4.66

Isoelectric Point (pI)

39.29

Instability Index

Protein Domains (Pfam)

Domain Name	Pfam ID	Position	E-value	Description
Rad60-SLD_2	PF13881	5 - 45	9.2e-14	Ubiquitin-2 like Rad60 SUMO-like

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0009060)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT4G24990 AT4G24990
fragaria_vesca	FvH4_5g08960
malus_domestica	MD06G1136800.v1.1 MD14G1151600.v1.1
prunus_persica	Prupe.5G146700_v2.0.a1 Prupe.5G146700_v2.0.a1
pyrus_communis	pycom06g12810
rosa_chinensis	RchiOBHm_Chr7g0189361 RchiOBHm_Chr7g0189411
rosa_laevigata	RLG00000004613
rosa_multiflora	Rmu_sc0001282.1_g000015
rosa_roxburghii	Rroxscaffold_3G00265500
rosa_rugosa	Rorug06G0497600 Rorug06G0497600 Rorug06G0497700
rosa_samantha	Rh7AG102500 Rh7BG105100 Rh7CG107000 Rh7DG104100 Rh7DG104500
rosa_wichuraiana	Rw7G008860

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AfaI	GTAC	1 cut(s)	41
AflII	CTTAAG	1 cut(s)	98
AgsI	TTSAA	1 cut(s)	147
AloI	GAACNNNNNNTCC	2 cut(s)	14, 46
AluBI	AGCT	1 cut(s)	69
AluI	AGCT	1 cut(s)	69
Alw26I	GTCTC	1 cut(s)	118
AoxI	GGCC	2 cut(s)	59, 122
AspS9I	GGNCC	2 cut(s)	59, 123
BccI	CCATC	1 cut(s)	38
BceAI	ACGGC	1 cut(s)	46
BcoDI	GTCTC	1 cut(s)	118
BfrI	CTTAAG	1 cut(s)	98
BmgT120I	GGNCC	2 cut(s)	59, 123
Bse1I	ACTGG	1 cut(s)	125
BseNI	ACTGG	1 cut(s)	125
BseRI	GAGGAG	1 cut(s)	23
BshFI	GGCC	2 cut(s)	61, 124
BsiSI	CCGG	1 cut(s)	5
BsmAI	GTCTC	1 cut(s)	118
BsmBI	CGTCTC	1 cut(s)	118
BsnI	GGCC	2 cut(s)	61, 124
BspANI	GGCC	2 cut(s)	61, 124
BspTI	CTTAAG	1 cut(s)	98
BsrI	ACTGG	1 cut(s)	125
Bst4CI	ACNGT	1 cut(s)	88
BstAFI	CTTAAG	1 cut(s)	98
BstMAI	GTCTC	1 cut(s)	118
BsuRI	GGCC	2 cut(s)	61, 124
Cfr13I	GGNCC	2 cut(s)	59, 123
Csp6I	GTAC	1 cut(s)	40
CviJI	RGCY	6 cut(s)	37, 48, 61, 69, 80, 124
CviKI_1	RGCY	6 cut(s)	37, 48, 61, 69, 80, 124
CviQI	GTAC	1 cut(s)	40
Esp3I	CGTCTC	1 cut(s)	118
FaiI	YATR	4 cut(s)	26, 56, 95, 174
HaeIII	GGCC	2 cut(s)	61, 124
HapII	CCGG	1 cut(s)	5
HpaII	CCGG	1 cut(s)	5
Hpy166II	GTNNAC	1 cut(s)	22
Hpy188I	TCNGA	2 cut(s)	52, 118
Hpy8I	GTNNAC	1 cut(s)	22
HpyCH4III	ACNGT	1 cut(s)	88
LpnPI	CCDG	3 cut(s)	18, 19, 106
MmeI	TCCRAC	1 cut(s)	141
MnlI	CCTC	3 cut(s)	4, 91, 99
MseI	TTAA	1 cut(s)	99
MspCI	CTTAAG	1 cut(s)	98
MspI	CCGG	1 cut(s)	5
PspPI	GGNCC	2 cut(s)	59, 123
RsaI	GTAC	1 cut(s)	41
RsaNI	GTAC	1 cut(s)	40
SaqAI	TTAA	1 cut(s)	99
Sau96I	GGNCC	2 cut(s)	59, 123
SetI	ASST	2 cut(s)	71, 133
SgeI	CNNG	4 cut(s)	17, 46, 133, 167
SmlI	CTYRAG	1 cut(s)	98
SmoI	CTYRAG	1 cut(s)	98
TaaI	ACNGT	1 cut(s)	88
TaqI	TCGA	1 cut(s)	90
Tru1I	TTAA	1 cut(s)	99
Tru9I	TTAA	1 cut(s)	99
Vha464I	CTTAAG	1 cut(s)	98

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.