RchiOBHm_Chr7g0189361

May serve as docking site to facilitate the association of other proteins to the plasma membrane

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_chinensis
7
OG0009060
Physical Location & Seq
Forward (+)
8681525 .. 8683990
2466 bp
Loading structure...
UTR
Exon/CDS
Intron
PRQ16910

Sequence Viewer

Length: 183 bp
ATGCCGGAGGAGGATTTGGTGGACATAAAGTTCAGGCTGTACGATGGCTCTGATATAGGGCCGTTCAGCTACTCATCAGCCTCCACAGTCGATATGCTTAAGCAGAGGGTCGTCTCCGACTGGCCCAAAGGGAAAACGATGATACCCAAGACGTCGAATGAAGTGAAGCTAAAATTTTGTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0005575 GO:0005623 GO:0005886 GO:0016020 GO:0044464 GO:0071944
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Rad60-SLD_2

Protein Analysis

60

Amino Acids

6.83

Weight (kDa)

6.11

Isoelectric Point (pI)

28.54

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Rad60-SLD_2 PF13881 5 - 57 4.5e-18 Ubiquitin-2 like Rad60 SUMO-like
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 155
AcsI RAATTY 1 cut(s) 173
AcyI GRCGYC 1 cut(s) 152
AfaI GTAC 1 cut(s) 41
AflII CTTAAG 1 cut(s) 98
AloI GAACNNNNNNTCC 2 cut(s) 14, 46
AluBI AGCT 2 cut(s) 69, 169
AluI AGCT 2 cut(s) 69, 169
Alw26I GTCTC 1 cut(s) 118
AoxI GGCC 2 cut(s) 59, 122
ApoI RAATTY 1 cut(s) 173
AspS9I GGNCC 2 cut(s) 59, 123
BccI CCATC 1 cut(s) 38
BceAI ACGGC 1 cut(s) 46
BcoDI GTCTC 1 cut(s) 118
BfrI CTTAAG 1 cut(s) 98
BmgT120I GGNCC 2 cut(s) 59, 123
BsaHI GRCGYC 1 cut(s) 152
Bse1I ACTGG 1 cut(s) 125
BseNI ACTGG 1 cut(s) 125
BseRI GAGGAG 1 cut(s) 23
BshFI GGCC 2 cut(s) 61, 124
BsiSI CCGG 1 cut(s) 5
BsmAI GTCTC 1 cut(s) 118
BsmBI CGTCTC 1 cut(s) 118
BsnI GGCC 2 cut(s) 61, 124
BspANI GGCC 2 cut(s) 61, 124
BspTI CTTAAG 1 cut(s) 98
BsrI ACTGG 1 cut(s) 125
BssNI GRCGYC 1 cut(s) 152
Bst4CI ACNGT 1 cut(s) 88
BstACI GRCGYC 1 cut(s) 152
BstAFI CTTAAG 1 cut(s) 98
BstMAI GTCTC 1 cut(s) 118
BsuRI GGCC 2 cut(s) 61, 124
Cfr13I GGNCC 2 cut(s) 59, 123
Csp6I GTAC 1 cut(s) 40
CviJI RGCY 7 cut(s) 37, 48, 61, 69, 80, 124, 169
CviKI_1 RGCY 7 cut(s) 37, 48, 61, 69, 80, 124, 169
CviQI GTAC 1 cut(s) 40
Esp3I CGTCTC 1 cut(s) 118
FaiI YATR 3 cut(s) 26, 56, 95
HaeIII GGCC 2 cut(s) 61, 124
HapII CCGG 1 cut(s) 5
Hin1I GRCGYC 1 cut(s) 152
HpaII CCGG 1 cut(s) 5
Hpy166II GTNNAC 1 cut(s) 22
Hpy188I TCNGA 2 cut(s) 52, 118
Hpy8I GTNNAC 1 cut(s) 22
Hpy99I CGWCG 1 cut(s) 157
HpyCH4III ACNGT 1 cut(s) 88
HpyCH4IV ACGT 1 cut(s) 152
HpySE526I ACGT 1 cut(s) 152
Hsp92I GRCGYC 1 cut(s) 152
LpnPI CCDG 3 cut(s) 18, 19, 106
MaeII ACGT 1 cut(s) 152
MluCI AATT 1 cut(s) 173
MmeI TCCRAC 1 cut(s) 141
MnlI CCTC 3 cut(s) 4, 91, 99
MseI TTAA 2 cut(s) 99, 181
MspCI CTTAAG 1 cut(s) 98
MspI CCGG 1 cut(s) 5
PspPI GGNCC 2 cut(s) 59, 123
RsaI GTAC 1 cut(s) 41
RsaNI GTAC 1 cut(s) 40
SaqAI TTAA 2 cut(s) 99, 181
Sau96I GGNCC 2 cut(s) 59, 123
SetI ASST 3 cut(s) 71, 155, 171
SgeI CNNG 4 cut(s) 17, 46, 133, 160
SmlI CTYRAG 1 cut(s) 98
SmoI CTYRAG 1 cut(s) 98
Sse9I AATT 1 cut(s) 173
TaaI ACNGT 1 cut(s) 88
TaiI ACGT 1 cut(s) 155
TaqI TCGA 2 cut(s) 90, 155
TasI AATT 1 cut(s) 173
Tru1I TTAA 2 cut(s) 99, 181
Tru9I TTAA 2 cut(s) 99, 181
TspDTI ATGAA 1 cut(s) 174
Vha464I CTTAAG 1 cut(s) 98
XapI RAATTY 1 cut(s) 173
ZraI GACGTC 1 cut(s) 153
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.