Rh7BG105100

May serve as docking site to facilitate the association of other proteins to the plasma membrane

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7B
OG0009060
Physical Location & Seq
Forward (+)
7864637 .. 7895341
30705 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7BG105100.1

Sequence Viewer

Length: 360 bp
ATGCCGGAGGAGGATTTGGTGGACATAAAGTTCAGGCTGTACGATGGCTCCGATATAGGGCCGATCAGCTACTCATCAGCCTCCACAGTCGATATGCTTAAGCAGAGGGTCGTCTCCGATTGGCCCAAAGGGAAAACGATGATACCCAAGACGTCGAATGAAGTGAAGCTAATGTGTTTTGGTAAAATTTTGGAGAACAACAAGACAGTGGGTCAGTGTAAATTACCTTTTGGTGATGTTGGTGGTGGGGGAGTTATGGTAATGCATGTTGTTGTACAGCCAACTATAGACAAAGCTAAATCAGACAAGAAGATTGATGACTTGCCCCGGAAAGTTGTCTGTTCGTGTTCCATATTGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0005575 GO:0005623 GO:0005886 GO:0016020 GO:0044464 GO:0071944
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Rad60-SLD_2

Protein Analysis

119

Amino Acids

13.05

Weight (kDa)

8.33

Isoelectric Point (pI)

33.12

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Rad60-SLD_2 PF13881 5 - 117 1.4e-38 Ubiquitin-2 like Rad60 SUMO-like
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AatII GACGTC 1 cut(s) 155
AcsI RAATTY 1 cut(s) 186
AcyI GRCGYC 1 cut(s) 152
AfaI GTAC 2 cut(s) 41, 276
AfiI CCNNNNNNNGG 1 cut(s) 57
AflII CTTAAG 1 cut(s) 98
AhdI GACNNNNNGTC 1 cut(s) 210
AloI GAACNNNNNNTCC 2 cut(s) 14, 46
AluBI AGCT 3 cut(s) 69, 169, 296
AluI AGCT 3 cut(s) 69, 169, 296
Alw26I GTCTC 1 cut(s) 118
AoxI GGCC 2 cut(s) 59, 122
ApoI RAATTY 1 cut(s) 186
AspS9I GGNCC 2 cut(s) 59, 123
AsuC2I CCSGG 1 cut(s) 328
AsuHPI GGTGA 1 cut(s) 245
BccI CCATC 1 cut(s) 38
BcnI CCSGG 1 cut(s) 328
BcoDI GTCTC 1 cut(s) 118
BfmI CTRYAG 1 cut(s) 285
BfrI CTTAAG 1 cut(s) 98
Bme1390I CCNGG 1 cut(s) 328
BmeRI GACNNNNNGTC 1 cut(s) 210
BmgT120I GGNCC 2 cut(s) 59, 123
BmiI GGNNCC 1 cut(s) 49
BmrFI CCNGG 1 cut(s) 328
BpuMI CCSGG 1 cut(s) 328
BsaHI GRCGYC 1 cut(s) 152
BsaJI CCNNGG 1 cut(s) 326
BsaXI ACNNNNNCTCC 4 cut(s) 32, 62, 243, 273
Bsc4I CCNNNNNNNGG 1 cut(s) 57
BseDI CCNNGG 1 cut(s) 326
BseLI CCNNNNNNNGG 1 cut(s) 57
BseRI GAGGAG 1 cut(s) 23
BshFI GGCC 2 cut(s) 61, 124
BsiSI CCGG 2 cut(s) 5, 328
BslI CCNNNNNNNGG 1 cut(s) 57
BsmAI GTCTC 1 cut(s) 118
BsmBI CGTCTC 1 cut(s) 118
BsnI GGCC 2 cut(s) 61, 124
Bsp1407I TGTACA 1 cut(s) 274
Bsp143I GATC 1 cut(s) 63
BspANI GGCC 2 cut(s) 61, 124
BspLI GGNNCC 1 cut(s) 49
BspTI CTTAAG 1 cut(s) 98
BsrGI TGTACA 1 cut(s) 274
BssECI CCNNGG 1 cut(s) 326
BssMI GATC 1 cut(s) 63
BssNI GRCGYC 1 cut(s) 152
Bst4CI ACNGT 2 cut(s) 88, 208
BstACI GRCGYC 1 cut(s) 152
BstAFI CTTAAG 1 cut(s) 98
BstAUI TGTACA 1 cut(s) 274
BstKTI GATC 1 cut(s) 66
BstMAI GTCTC 1 cut(s) 118
BstMBI GATC 1 cut(s) 63
BstNSI RCATGY 1 cut(s) 269
BstSCI CCNGG 1 cut(s) 326
BstSFI CTRYAG 1 cut(s) 285
BsuRI GGCC 2 cut(s) 61, 124
BtsIMutI CAGTG 2 cut(s) 213, 221
Cfr13I GGNCC 2 cut(s) 59, 123
Csp6I GTAC 2 cut(s) 40, 275
CviAII CATG 1 cut(s) 266
CviJI RGCY 9 cut(s) 37, 48, 61, 69, 80, 124, 169, 280, 296
CviKI_1 RGCY 9 cut(s) 37, 48, 61, 69, 80, 124, 169, 280, 296
CviQI GTAC 2 cut(s) 40, 275
DpnI GATC 1 cut(s) 65
DpnII GATC 1 cut(s) 63
DriI GACNNNNNGTC 1 cut(s) 210
Eam1105I GACNNNNNGTC 1 cut(s) 210
EcoT22I ATGCAT 1 cut(s) 267
Esp3I CGTCTC 1 cut(s) 118
FaeI CATG 1 cut(s) 269
FaiI YATR 7 cut(s) 26, 56, 95, 257, 267, 287, 353
FatI CATG 1 cut(s) 265
HaeIII GGCC 2 cut(s) 61, 124
HapII CCGG 2 cut(s) 5, 328
Hin1I GRCGYC 1 cut(s) 152
Hin1II CATG 1 cut(s) 269
HpaII CCGG 2 cut(s) 5, 328
HphI GGTGA 1 cut(s) 245
Hpy166II GTNNAC 1 cut(s) 22
Hpy188I TCNGA 3 cut(s) 52, 118, 304
Hpy8I GTNNAC 1 cut(s) 22
Hpy99I CGWCG 1 cut(s) 157
HpyCH4III ACNGT 2 cut(s) 88, 208
HpyCH4IV ACGT 1 cut(s) 152
HpyCH4V TGCA 1 cut(s) 265
HpySE526I ACGT 1 cut(s) 152
Hsp92I GRCGYC 1 cut(s) 152
Hsp92II CATG 1 cut(s) 269
Kzo9I GATC 1 cut(s) 63
LmnI GCTCC 1 cut(s) 53
LpnPI CCDG 3 cut(s) 18, 19, 341
MaeII ACGT 1 cut(s) 152
MalI GATC 1 cut(s) 65
MboI GATC 1 cut(s) 63
MboII GAAGA 1 cut(s) 322
MluCI AATT 2 cut(s) 186, 221
MnlI CCTC 3 cut(s) 4, 91, 99
Mph1103I ATGCAT 1 cut(s) 267
MseI TTAA 1 cut(s) 99
MspCI CTTAAG 1 cut(s) 98
MspI CCGG 2 cut(s) 5, 328
MspR9I CCNGG 1 cut(s) 328
NciI CCSGG 1 cut(s) 328
NdeII GATC 1 cut(s) 63
NlaIII CATG 1 cut(s) 269
NlaIV GGNNCC 1 cut(s) 49
NsiI ATGCAT 1 cut(s) 267
NspI RCATGY 1 cut(s) 269
PcsI WCGNNNNNNNCGW 1 cut(s) 48
PspN4I GGNNCC 1 cut(s) 49
PspPI GGNCC 2 cut(s) 59, 123
RsaI GTAC 2 cut(s) 41, 276
RsaNI GTAC 2 cut(s) 40, 275
SaqAI TTAA 1 cut(s) 99
Sau3AI GATC 1 cut(s) 63
Sau96I GGNCC 2 cut(s) 59, 123
ScrFI CCNGG 1 cut(s) 328
SetI ASST 5 cut(s) 71, 155, 171, 229, 298
SfcI CTRYAG 1 cut(s) 285
SgeI CNNG 9 cut(s) 17, 46, 160, 214, 278, 319, 334, 339, 340
SmlI CTYRAG 1 cut(s) 98
SmoI CTYRAG 1 cut(s) 98
Sse9I AATT 2 cut(s) 186, 221
StyD4I CCNGG 1 cut(s) 326
TaaI ACNGT 2 cut(s) 88, 208
TaiI ACGT 1 cut(s) 155
TaqI TCGA 2 cut(s) 90, 155
TasI AATT 2 cut(s) 186, 221
TatI WGTACW 1 cut(s) 274
Tru1I TTAA 1 cut(s) 99
Tru9I TTAA 1 cut(s) 99
TscAI CASTG 2 cut(s) 213, 221
TspDTI ATGAA 1 cut(s) 174
TspRI CASTG 2 cut(s) 213, 221
Vha464I CTTAAG 1 cut(s) 98
XapI RAATTY 1 cut(s) 186
XceI RCATGY 1 cut(s) 269
ZraI GACGTC 1 cut(s) 153
Zsp2I ATGCAT 1 cut(s) 267
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.