Rh7CG107000

May serve as docking site to facilitate the association of other proteins to the plasma membrane

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
rosa_samantha
Chr7C
OG0009060
Physical Location & Seq
Forward (+)
8200116 .. 8202287
2172 bp
Loading structure...
UTR
Exon/CDS
Intron
Rh7CG107000.1

Sequence Viewer

Length: 315 bp
ATGCCGGAGGAGGATTTGGTGGACATAAAGTTCAGGCTGTACGATGGCTCCGATATAGGGCCGTTCAGCTACTCATCAACCTCCACAGTCGATATGCTTAAGCAGAGGGTCGTCTCCGATTGGCCCAAAGGGAAAACGATGATACCCAAGACGTGGAATGAAGTGAAGCTAATGTGTTTTGGTAAAATTTTGGAGAACAGCAAGACAGTGGGTCAGTGTAAATTACCTTTTGGTGATGTTGGTGGTGGGGGAGTTATGGTAATGCATGTTGTTGTACAGCCAACTATAGACAAAGCTAAATCAGGTATGATCTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0005575 GO:0005623 GO:0005886 GO:0016020 GO:0044464 GO:0071944
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Rad60-SLD_2

Protein Analysis

104

Amino Acids

11.47

Weight (kDa)

7.74

Isoelectric Point (pI)

32.11

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Rad60-SLD_2 PF13881 5 - 101 2.1e-35 Ubiquitin-2 like Rad60 SUMO-like
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 153
AcsI RAATTY 1 cut(s) 186
AfaI GTAC 2 cut(s) 41, 276
AfiI CCNNNNNNNGG 2 cut(s) 57, 153
AflII CTTAAG 1 cut(s) 98
AhdI GACNNNNNGTC 1 cut(s) 210
AjiI CACGTC 1 cut(s) 153
AloI GAACNNNNNNTCC 2 cut(s) 14, 46
AluBI AGCT 3 cut(s) 69, 169, 296
AluI AGCT 3 cut(s) 69, 169, 296
Alw26I GTCTC 1 cut(s) 118
AoxI GGCC 2 cut(s) 59, 122
ApoI RAATTY 1 cut(s) 186
AspS9I GGNCC 2 cut(s) 59, 123
AsuHPI GGTGA 1 cut(s) 245
BccI CCATC 1 cut(s) 38
BceAI ACGGC 1 cut(s) 46
BcoDI GTCTC 1 cut(s) 118
BfmI CTRYAG 1 cut(s) 285
BfrI CTTAAG 1 cut(s) 98
BmeRI GACNNNNNGTC 1 cut(s) 210
BmgBI CACGTC 1 cut(s) 153
BmgT120I GGNCC 2 cut(s) 59, 123
BmiI GGNNCC 1 cut(s) 49
BsaXI ACNNNNNCTCC 4 cut(s) 32, 62, 243, 273
Bsc4I CCNNNNNNNGG 2 cut(s) 57, 153
BseLI CCNNNNNNNGG 2 cut(s) 57, 153
BseRI GAGGAG 1 cut(s) 23
BshFI GGCC 2 cut(s) 61, 124
BsiSI CCGG 1 cut(s) 5
BslI CCNNNNNNNGG 2 cut(s) 57, 153
BsmAI GTCTC 1 cut(s) 118
BsmBI CGTCTC 1 cut(s) 118
BsnI GGCC 2 cut(s) 61, 124
Bsp1407I TGTACA 1 cut(s) 274
Bsp143I GATC 1 cut(s) 309
BspANI GGCC 2 cut(s) 61, 124
BspLI GGNNCC 1 cut(s) 49
BspTI CTTAAG 1 cut(s) 98
BsrGI TGTACA 1 cut(s) 274
BssMI GATC 1 cut(s) 309
Bst4CI ACNGT 2 cut(s) 88, 208
BstAFI CTTAAG 1 cut(s) 98
BstAUI TGTACA 1 cut(s) 274
BstKTI GATC 1 cut(s) 312
BstMAI GTCTC 1 cut(s) 118
BstMBI GATC 1 cut(s) 309
BstNSI RCATGY 1 cut(s) 269
BstSFI CTRYAG 1 cut(s) 285
BsuRI GGCC 2 cut(s) 61, 124
BtrI CACGTC 1 cut(s) 153
BtsIMutI CAGTG 2 cut(s) 213, 221
Cfr13I GGNCC 2 cut(s) 59, 123
Csp6I GTAC 2 cut(s) 40, 275
CviAII CATG 1 cut(s) 266
CviJI RGCY 8 cut(s) 37, 48, 61, 69, 124, 169, 280, 296
CviKI_1 RGCY 8 cut(s) 37, 48, 61, 69, 124, 169, 280, 296
CviQI GTAC 2 cut(s) 40, 275
DpnI GATC 1 cut(s) 311
DpnII GATC 1 cut(s) 309
DriI GACNNNNNGTC 1 cut(s) 210
Eam1105I GACNNNNNGTC 1 cut(s) 210
EcoT22I ATGCAT 1 cut(s) 267
Esp3I CGTCTC 1 cut(s) 118
FaeI CATG 1 cut(s) 269
FaiI YATR 7 cut(s) 26, 56, 95, 257, 267, 287, 308
FatI CATG 1 cut(s) 265
HaeIII GGCC 2 cut(s) 61, 124
HapII CCGG 1 cut(s) 5
Hin1II CATG 1 cut(s) 269
HpaII CCGG 1 cut(s) 5
HphI GGTGA 1 cut(s) 245
Hpy166II GTNNAC 1 cut(s) 22
Hpy188I TCNGA 3 cut(s) 52, 118, 314
Hpy8I GTNNAC 1 cut(s) 22
HpyCH4III ACNGT 2 cut(s) 88, 208
HpyCH4IV ACGT 1 cut(s) 152
HpyCH4V TGCA 1 cut(s) 265
HpySE526I ACGT 1 cut(s) 152
Hsp92II CATG 1 cut(s) 269
Kzo9I GATC 1 cut(s) 309
LmnI GCTCC 1 cut(s) 53
LpnPI CCDG 3 cut(s) 18, 19, 288
MaeII ACGT 1 cut(s) 152
MalI GATC 1 cut(s) 311
MboI GATC 1 cut(s) 309
MluCI AATT 2 cut(s) 186, 221
MnlI CCTC 3 cut(s) 4, 91, 99
Mph1103I ATGCAT 1 cut(s) 267
MseI TTAA 1 cut(s) 99
MspCI CTTAAG 1 cut(s) 98
MspI CCGG 1 cut(s) 5
NdeII GATC 1 cut(s) 309
NlaIII CATG 1 cut(s) 269
NlaIV GGNNCC 1 cut(s) 49
NsiI ATGCAT 1 cut(s) 267
NspI RCATGY 1 cut(s) 269
PcsI WCGNNNNNNNCGW 1 cut(s) 48
PflMI CCANNNNNTGG 1 cut(s) 153
PspN4I GGNNCC 1 cut(s) 49
PspPI GGNCC 2 cut(s) 59, 123
RsaI GTAC 2 cut(s) 41, 276
RsaNI GTAC 2 cut(s) 40, 275
SaqAI TTAA 1 cut(s) 99
Sau3AI GATC 1 cut(s) 309
Sau96I GGNCC 2 cut(s) 59, 123
SetI ASST 7 cut(s) 71, 83, 155, 171, 229, 298, 307
SfcI CTRYAG 1 cut(s) 285
SgeI CNNG 6 cut(s) 17, 46, 160, 165, 214, 278
SmlI CTYRAG 1 cut(s) 98
SmoI CTYRAG 1 cut(s) 98
Sse9I AATT 2 cut(s) 186, 221
TaaI ACNGT 2 cut(s) 88, 208
TaiI ACGT 1 cut(s) 155
TaqI TCGA 1 cut(s) 90
TasI AATT 2 cut(s) 186, 221
TatI WGTACW 1 cut(s) 274
Tru1I TTAA 1 cut(s) 99
Tru9I TTAA 1 cut(s) 99
TscAI CASTG 2 cut(s) 213, 221
TspDTI ATGAA 1 cut(s) 174
TspRI CASTG 2 cut(s) 213, 221
Van91I CCANNNNNTGG 1 cut(s) 153
Vha464I CTTAAG 1 cut(s) 98
XapI RAATTY 1 cut(s) 186
XceI RCATGY 1 cut(s) 269
Zsp2I ATGCAT 1 cut(s) 267
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.