MD06G1179100.v1.1

Belongs to the ubiquitin-conjugating enzyme family

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr06
Physical Location & Seq
Reverse (-)
31900851 .. 31905807
4957 bp
Loading structure...
UTR
Exon/CDS
Intron
MD06G1179100.v1.1.491

Sequence Viewer

Length: 123 bp
ATGATCAGAAGGTCAAAGTACTGTGAGCGACATGCAAAGAAGGAACACATTACCAATACAACACCAGACGAGGAGCGCGATGAGAACATTAGTGATGAGGAAAGCAAACTCAAGGGACAATGA

Protein Analysis

41

Amino Acids

4.8

Weight (kDa)

6.06

Isoelectric Point (pI)

66.94

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccII CGCG 1 cut(s) 78
AfaI GTAC 1 cut(s) 20
AspLEI GCGC 1 cut(s) 78
BclI TGATCA 1 cut(s) 3
BmcAI AGTACT 1 cut(s) 20
BpuEI CTTGAG 1 cut(s) 95
BseRI GAGGAG 1 cut(s) 86
Bsh1236I CGCG 1 cut(s) 78
Bsp143I GATC 1 cut(s) 3
BspFNI CGCG 1 cut(s) 78
BssMI GATC 1 cut(s) 3
Bst4CI ACNGT 1 cut(s) 23
BstFNI CGCG 1 cut(s) 78
BstHHI GCGC 1 cut(s) 78
BstKTI GATC 1 cut(s) 6
BstMBI GATC 1 cut(s) 3
BstNSI RCATGY 1 cut(s) 35
BstUI CGCG 1 cut(s) 78
BtgZI GCGATG 1 cut(s) 93
CfoI GCGC 1 cut(s) 78
Csp6I GTAC 1 cut(s) 19
CviAII CATG 1 cut(s) 32
CviQI GTAC 1 cut(s) 19
DpnI GATC 1 cut(s) 5
DpnII GATC 1 cut(s) 3
FaeI CATG 1 cut(s) 35
FaiI YATR 1 cut(s) 33
FatI CATG 1 cut(s) 31
FbaI TGATCA 1 cut(s) 3
FspEI CC 7 cut(s) 26, 56, 67, 78, 83, 98, 99
GlaI GCGC 1 cut(s) 77
HhaI GCGC 1 cut(s) 78
Hin1II CATG 1 cut(s) 35
Hin6I GCGC 1 cut(s) 76
HinP1I GCGC 1 cut(s) 76
Hpy188I TCNGA 1 cut(s) 8
HpyAV CCTTC 2 cut(s) 3, 34
HpyCH4III ACNGT 1 cut(s) 23
HpyCH4V TGCA 1 cut(s) 35
Hsp92II CATG 1 cut(s) 35
HspAI GCGC 1 cut(s) 76
Ksp22I TGATCA 1 cut(s) 3
Kzo9I GATC 1 cut(s) 3
LmnI GCTCC 1 cut(s) 73
LpnPI CCDG 1 cut(s) 78
MalI GATC 1 cut(s) 5
MboI GATC 1 cut(s) 3
MnlI CCTC 2 cut(s) 64, 91
MvnI CGCG 1 cut(s) 78
NdeII GATC 1 cut(s) 3
NlaIII CATG 1 cut(s) 35
NspI RCATGY 1 cut(s) 35
PcsI WCGNNNNNNNCGW 1 cut(s) 75
RsaI GTAC 1 cut(s) 20
RsaNI GTAC 1 cut(s) 19
Sau3AI GATC 1 cut(s) 3
ScaI AGTACT 1 cut(s) 20
SetI ASST 1 cut(s) 14
SgeI CNNG 4 cut(s) 44, 77, 82, 89
SmlI CTYRAG 1 cut(s) 110
SmoI CTYRAG 1 cut(s) 110
TaaI ACNGT 1 cut(s) 23
TatI WGTACW 1 cut(s) 18
XceI RCATGY 1 cut(s) 35
ZrmI AGTACT 1 cut(s) 20
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.