MD07G1147100.v1.1
MYB Family

transcription factor

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr07
Physical Location & Seq
Reverse (-)
21491307 .. 21493285
1979 bp
Loading structure...
UTR
Exon/CDS
Intron
MD07G1147100.v1.1.491

Sequence Viewer

Length: 198 bp
ATGACTGAACAAGAAGAAGATCTCATTTGCAGAATGTATAAGCTCGTCGGAGACAGGTGGGCTCTTATAGCTGGGAGGCTTCCAGGCCGGAAAGCGGAAGAAATAGAGAGGTTCTGGTTAATGAGACATGGAGAAGTATTTGCAAGTAGAAGAAGAACAGAGCTTAAGACGACCAATAACAGATACAACAACTCCTGA

Protein Analysis

66

Amino Acids

7.84

Weight (kDa)

9.5

Isoelectric Point (pI)

70.06

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
Myb_DNA-binding PF00249 2 - 41 3.1e-09 Myb-like DNA-binding domain
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Orthologous Genes (Group: OG0009823)

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 95
AfiI CCNNNNNNNGG 1 cut(s) 94
AflII CTTAAG 1 cut(s) 164
AjnI CCWGG 1 cut(s) 82
AluBI AGCT 3 cut(s) 43, 71, 163
AluI AGCT 3 cut(s) 43, 71, 163
Alw26I GTCTC 2 cut(s) 45, 118
AoxI GGCC 1 cut(s) 85
BanII GRGCYC 1 cut(s) 64
BciT130I CCWGG 1 cut(s) 84
BcoDI GTCTC 2 cut(s) 45, 118
BfrI CTTAAG 1 cut(s) 164
BglII AGATCT 1 cut(s) 19
Bme1390I CCNGG 1 cut(s) 84
BmrFI CCNGG 1 cut(s) 84
BsaXI ACNNNNNCTCC 1 cut(s) 176
Bsc4I CCNNNNNNNGG 1 cut(s) 94
BseBI CCWGG 1 cut(s) 84
BseLI CCNNNNNNNGG 1 cut(s) 94
BseYI CCCAGC 1 cut(s) 71
BshFI GGCC 1 cut(s) 87
BsiSI CCGG 1 cut(s) 88
BslI CCNNNNNNNGG 1 cut(s) 94
BsmAI GTCTC 2 cut(s) 45, 118
BsnI GGCC 1 cut(s) 87
Bsp1286I GDGCHC 1 cut(s) 64
Bsp143I GATC 1 cut(s) 19
BspACI CCGC 1 cut(s) 95
BspANI GGCC 1 cut(s) 87
BspTI CTTAAG 1 cut(s) 164
BssMI GATC 1 cut(s) 19
Bst2UI CCWGG 1 cut(s) 84
BstAFI CTTAAG 1 cut(s) 164
BstKTI GATC 1 cut(s) 22
BstMAI GTCTC 2 cut(s) 45, 118
BstMBI GATC 1 cut(s) 19
BstMWI GCNNNNNNNGC 1 cut(s) 68
BstNI CCWGG 1 cut(s) 84
BstSCI CCNGG 1 cut(s) 82
BstX2I RGATCY 1 cut(s) 19
BstYI RGATCY 1 cut(s) 19
BsuRI GGCC 1 cut(s) 87
CviAII CATG 1 cut(s) 128
CviJI RGCY 6 cut(s) 43, 62, 71, 79, 87, 163
CviKI_1 RGCY 6 cut(s) 43, 62, 71, 79, 87, 163
DpnI GATC 1 cut(s) 21
DpnII GATC 1 cut(s) 19
Eco24I GRGCYC 1 cut(s) 64
EcoRII CCWGG 1 cut(s) 82
EcoT38I GRGCYC 1 cut(s) 64
FaeI CATG 1 cut(s) 131
FaiI YATR 3 cut(s) 39, 68, 129
FatI CATG 1 cut(s) 127
FriOI GRGCYC 1 cut(s) 64
GsaI CCCAGC 1 cut(s) 75
HaeIII GGCC 1 cut(s) 87
HapII CCGG 1 cut(s) 88
Hin1II CATG 1 cut(s) 131
HpaII CCGG 1 cut(s) 88
Hpy188I TCNGA 1 cut(s) 50
Hpy188III TCNNGA 1 cut(s) 195
Hpy99I CGWCG 1 cut(s) 50
HpyCH4V TGCA 2 cut(s) 30, 143
HpyF10VI GCNNNNNNNGC 1 cut(s) 68
Hsp92II CATG 1 cut(s) 131
Kzo9I GATC 1 cut(s) 19
LpnPI CCDG 6 cut(s) 40, 57, 69, 96, 100, 101
MalI GATC 1 cut(s) 21
MboI GATC 1 cut(s) 19
MboII GAAGA 5 cut(s) 26, 29, 110, 162, 165
MflI RGATCY 1 cut(s) 19
MhlI GDGCHC 1 cut(s) 64
MmeI TCCRAC 1 cut(s) 28
MnlI CCTC 2 cut(s) 69, 102
MseI TTAA 2 cut(s) 119, 165
MspCI CTTAAG 1 cut(s) 164
MspI CCGG 1 cut(s) 88
MspR9I CCNGG 1 cut(s) 84
MvaI CCWGG 1 cut(s) 84
MwoI GCNNNNNNNGC 1 cut(s) 68
NdeII GATC 1 cut(s) 19
NlaIII CATG 1 cut(s) 131
Psp6I CCWGG 1 cut(s) 82
PspFI CCCAGC 1 cut(s) 71
PspGI CCWGG 1 cut(s) 82
PsuI RGATCY 1 cut(s) 19
SaqAI TTAA 2 cut(s) 119, 165
Sau3AI GATC 1 cut(s) 19
ScrFI CCNGG 1 cut(s) 84
SduI GDGCHC 1 cut(s) 64
SetI ASST 5 cut(s) 45, 59, 73, 113, 165
SmlI CTYRAG 1 cut(s) 164
SmoI CTYRAG 1 cut(s) 164
SsiI CCGC 1 cut(s) 95
StyD4I CCNGG 1 cut(s) 82
Tru1I TTAA 2 cut(s) 119, 165
Tru9I TTAA 2 cut(s) 119, 165
Vha464I CTTAAG 1 cut(s) 164
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.