MD09G1205700.v1.1

No description available

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr09
Physical Location & Seq
Forward (+)
19641324 .. 19642291
968 bp
Loading structure...
UTR
Exon/CDS
Intron
MD09G1205700.v1.1.491

Sequence Viewer

Length: 270 bp
ATGGCTAAAGTTTGCCGTTCAATTGAGACAGAGCCTAGAACCTTGAGTGAAGGGCAACTCAACCGTGCTAGGGAAATTGCTGCTGATGTAGTTCAGAAAATGGAACCAACTGAAGCCACAGCTCTATTCATTGAGACTAAGCTTCTGGACTGGAAGGAGGAGGCTCAAATTTTAGAAAGGCCTTGCCAATGCTTGTGCTCTACGGCCATTGTTGAAACGCCCGATCAAGAAACGCAACTTATTACAGGACCTGTGTCGGCCCCATTTTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

90

Amino Acids

9.92

Weight (kDa)

4.56

Isoelectric Point (pI)

51.69

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcoI YGGCCR 1 cut(s) 204
AcsI RAATTY 1 cut(s) 168
AcuI CTGAAG 1 cut(s) 132
AfiI CCNNNNNNNGG 1 cut(s) 70
AgsI TTSAA 2 cut(s) 21, 215
AluBI AGCT 2 cut(s) 122, 142
AluI AGCT 2 cut(s) 122, 142
Alw21I GWGCWC 1 cut(s) 200
Alw26I GTCTC 2 cut(s) 20, 128
AlwNI CAGNNNCTG 1 cut(s) 251
AoxI GGCC 3 cut(s) 179, 204, 258
ApeKI GCWGC 1 cut(s) 80
ApoI RAATTY 1 cut(s) 168
AspS9I GGNCC 2 cut(s) 248, 259
AvaII GGWCC 1 cut(s) 248
Bbv12I GWGCWC 1 cut(s) 200
BbvI GCAGC 1 cut(s) 67
BceAI ACGGC 1 cut(s) 219
BcoDI GTCTC 2 cut(s) 20, 128
BfaI CTAG 2 cut(s) 36, 69
BisI GCNGC 1 cut(s) 81
BlsI GCNGC 1 cut(s) 82
Bme18I GGWCC 1 cut(s) 248
BmgT120I GGNCC 2 cut(s) 248, 259
BmiI GGNNCC 2 cut(s) 105, 261
BoxI GACNNNNGTC 1 cut(s) 253
BpuEI CTTGAG 1 cut(s) 64
Bsc4I CCNNNNNNNGG 1 cut(s) 70
Bse1I ACTGG 1 cut(s) 155
BseLI CCNNNNNNNGG 1 cut(s) 70
BseNI ACTGG 1 cut(s) 155
BseRI GAGGAG 1 cut(s) 173
BseXI GCAGC 1 cut(s) 67
BshFI GGCC 3 cut(s) 181, 206, 260
BsiHKAI GWGCWC 1 cut(s) 200
BslI CCNNNNNNNGG 1 cut(s) 70
BsmAI GTCTC 2 cut(s) 20, 128
BsnI GGCC 3 cut(s) 181, 206, 260
Bsp1286I GDGCHC 1 cut(s) 200
Bsp143I GATC 1 cut(s) 223
BspANI GGCC 3 cut(s) 181, 206, 260
BspLI GGNNCC 2 cut(s) 105, 261
BsrI ACTGG 1 cut(s) 155
BssMI GATC 1 cut(s) 223
Bst4CI ACNGT 1 cut(s) 65
BstDEI CTNAG 1 cut(s) 138
BstKTI GATC 1 cut(s) 226
BstMAI GTCTC 2 cut(s) 20, 128
BstMBI GATC 1 cut(s) 223
BstPAI GACNNNNGTC 1 cut(s) 253
BstV1I GCAGC 1 cut(s) 67
BsuRI GGCC 3 cut(s) 181, 206, 260
CaiI CAGNNNCTG 1 cut(s) 251
Cfr13I GGNCC 2 cut(s) 248, 259
CviJI RGCY 9 cut(s) 5, 34, 116, 122, 142, 164, 181, 206, 260
CviKI_1 RGCY 9 cut(s) 5, 34, 116, 122, 142, 164, 181, 206, 260
DdeI CTNAG 1 cut(s) 138
DpnI GATC 1 cut(s) 225
DpnII GATC 1 cut(s) 223
EaeI YGGCCR 1 cut(s) 204
Eco147I AGGCCT 1 cut(s) 181
Eco47I GGWCC 1 cut(s) 248
Eco57I CTGAAG 1 cut(s) 132
EcoO109I RGGNCCY 1 cut(s) 248
Fnu4HI GCNGC 1 cut(s) 81
Fsp4HI GCNGC 1 cut(s) 81
FspBI CTAG 2 cut(s) 36, 69
GluI GCNGC 1 cut(s) 81
HaeIII GGCC 3 cut(s) 181, 206, 260
HindIII AAGCTT 1 cut(s) 140
Hpy188I TCNGA 1 cut(s) 96
Hpy188III TCNNGA 2 cut(s) 146, 227
HpyAV CCTTC 2 cut(s) 44, 148
HpyCH4III ACNGT 1 cut(s) 65
HpyF3I CTNAG 1 cut(s) 138
Kzo9I GATC 1 cut(s) 223
LpnPI CCDG 4 cut(s) 131, 136, 231, 264
Lsp1109I GCAGC 1 cut(s) 67
MaeI CTAG 2 cut(s) 36, 69
MalI GATC 1 cut(s) 225
MboI GATC 1 cut(s) 223
MfeI CAATTG 1 cut(s) 21
MhlI GDGCHC 1 cut(s) 200
MluCI AATT 3 cut(s) 21, 75, 168
MnlI CCTC 2 cut(s) 151, 154
MunI CAATTG 1 cut(s) 21
NdeII GATC 1 cut(s) 223
NlaIV GGNNCC 2 cut(s) 105, 261
PceI AGGCCT 1 cut(s) 181
PkrI GCNGC 1 cut(s) 82
PpuMI RGGWCCY 1 cut(s) 248
PshAI GACNNNNGTC 1 cut(s) 253
Psp5II RGGWCCY 1 cut(s) 248
PspN4I GGNNCC 2 cut(s) 105, 261
PspPI GGNCC 2 cut(s) 248, 259
PspPPI RGGWCCY 1 cut(s) 248
PstNI CAGNNNCTG 1 cut(s) 251
SatI GCNGC 1 cut(s) 81
Sau3AI GATC 1 cut(s) 223
Sau96I GGNCC 2 cut(s) 248, 259
SduI GDGCHC 1 cut(s) 200
SetI ASST 4 cut(s) 44, 124, 144, 253
SinI GGWCC 1 cut(s) 248
SmlI CTYRAG 1 cut(s) 43
SmoI CTYRAG 1 cut(s) 43
Sse9I AATT 3 cut(s) 21, 75, 168
SseBI AGGCCT 1 cut(s) 181
SspMI CTAG 2 cut(s) 36, 69
StuI AGGCCT 1 cut(s) 181
TaaI ACNGT 1 cut(s) 65
TasI AATT 3 cut(s) 21, 75, 168
TseI GCWGC 1 cut(s) 80
TspDTI ATGAA 1 cut(s) 118
VpaK11BI GGWCC 1 cut(s) 248
XapI RAATTY 1 cut(s) 168
XspI CTAG 2 cut(s) 36, 69
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.