Basic Information

Type: gene

Biological Identity

Species

rosa_samantha

Chromosome

Chr2B

Orthogroup ID

OG0014771

Physical Location & Seq

Genomic Coordinates Reverse (-)

59288018 .. 59290128

Gene Structure 2111 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Rh2BG421900.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 318 bp

ATGGGCCAGTCTATATATGCATCAACAATACTACTGATCGATGATAGTACCACCGCTGGTGTTTTTGAGAAATTTGAGCTCGATCAAGTCTGTTCGTTTTTCATGGCCACAGTTTGTTGCTCCATTGAGATGGAACCTAGGACCTTGAGTCAAGTACAACTCAACCATGCTAGGGAAATGGCTGAAGATGTGGTTCAGAAAATGGAATCAAACGAAGCCTCAGCTACATTCAGTGAGGTGTGGTTTTACTTCACAAGTTCACAGCATCCATCATATCTAGCTATGAACTCAAACCTAGAATCGGTTATGAGTACGTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

105

Amino Acids

11.8

Weight (kDa)

4.23

Isoelectric Point (pI)

52.2

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0014771)

Species	Orthologous Gene IDs
fragaria_vesca	FvH4_6g32180
malus_domestica	MD09G1205700.v1.1 MD17G1186400.v1.1
prunus_persica	Prupe.3G061100_v2.0.a1 Prupe.3G061100_v2.0.a1
rosa_chinensis	RchiOBHm_Chr2g0140071
rosa_laevigata	RLG00000019846
rosa_multiflora	Rmu_sc0003365.1_g000002 Rmu_sc0013099.1_g000005
rosa_roxburghii	Rroxscaffold_2G00105080
rosa_rugosa	Rorug02G0360900 Rorug02G0360900
rosa_samantha	Rh2AG411600 Rh2BG421900 Rh2CG397700 Rh2DG431300
rosa_wichuraiana	Rw2G033720

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	54
AcoI	YGGCCR	1 cut(s)	105
AcsI	RAATTY	1 cut(s)	71
AcuI	CTGAAG	1 cut(s)	204
AfaI	GTAC	3 cut(s)	49, 156, 313
AfiI	CCNNNNNNNGG	2 cut(s)	172, 301
AhdI	GACNNNNNGTC	1 cut(s)	147
AluBI	AGCT	3 cut(s)	79, 224, 281
AluI	AGCT	3 cut(s)	79, 224, 281
Alw21I	GWGCWC	1 cut(s)	81
AoxI	GGCC	2 cut(s)	4, 105
ApoI	RAATTY	1 cut(s)	71
AspA2I	CCTAGG	1 cut(s)	137
AspS9I	GGNCC	2 cut(s)	4, 141
AvaII	GGWCC	1 cut(s)	141
AvrII	CCTAGG	1 cut(s)	137
BalI	TGGCCA	1 cut(s)	107
BanII	GRGCYC	1 cut(s)	81
Bbv12I	GWGCWC	1 cut(s)	81
BbvCI	CCTCAGC	1 cut(s)	220
BccI	CCATC	2 cut(s)	124, 277
BfaI	CTAG	4 cut(s)	138, 171, 278, 296
BlnI	CCTAGG	1 cut(s)	137
Bme18I	GGWCC	1 cut(s)	141
BmeRI	GACNNNNNGTC	1 cut(s)	147
BmgT120I	GGNCC	2 cut(s)	4, 141
BmiI	GGNNCC	1 cut(s)	135
BmsI	GCATC	2 cut(s)	29, 274
Bpu10I	CCTNAGC	1 cut(s)	220
BpuEI	CTTGAG	1 cut(s)	166
Bsa29I	ATCGAT	1 cut(s)	39
BsaAI	YACGTR	1 cut(s)	315
BsaJI	CCNNGG	1 cut(s)	137
Bsc4I	CCNNNNNNNGG	2 cut(s)	172, 301
Bse1I	ACTGG	1 cut(s)	7
BseCI	ATCGAT	1 cut(s)	39
BseDI	CCNNGG	1 cut(s)	137
BseGI	GGATG	1 cut(s)	265
BseLI	CCNNNNNNNGG	2 cut(s)	172, 301
BseMII	CTCAG	1 cut(s)	234
BseNI	ACTGG	1 cut(s)	7
BshFI	GGCC	2 cut(s)	6, 107
BshVI	ATCGAT	1 cut(s)	39
BsiHKAI	GWGCWC	1 cut(s)	81
BslI	CCNNNNNNNGG	2 cut(s)	172, 301
BsnI	GGCC	2 cut(s)	6, 107
Bsp1286I	GDGCHC	1 cut(s)	81
Bsp143I	GATC	2 cut(s)	36, 82
BspACI	CCGC	1 cut(s)	54
BspANI	GGCC	2 cut(s)	6, 107
BspCNI	CTCAG	1 cut(s)	233
BspDI	ATCGAT	1 cut(s)	39
BspLI	GGNNCC	1 cut(s)	135
BsrI	ACTGG	1 cut(s)	7
BssECI	CCNNGG	1 cut(s)	137
BssMI	GATC	2 cut(s)	36, 82
BssT1I	CCWWGG	1 cut(s)	137
Bst4CI	ACNGT	1 cut(s)	112
BstBAI	YACGTR	1 cut(s)	315
BstDEI	CTNAG	1 cut(s)	220
BstF5I	GGATG	1 cut(s)	265
BstKTI	GATC	2 cut(s)	39, 85
BstMBI	GATC	2 cut(s)	36, 82
BstSNI	TACGTA	1 cut(s)	315
BstXI	CCANNNNNNTGG	1 cut(s)	130
Bsu15I	ATCGAT	1 cut(s)	39
BsuRI	GGCC	2 cut(s)	6, 107
BsuTUI	ATCGAT	1 cut(s)	39
BtsCI	GGATG	1 cut(s)	265
BtsIMutI	CAGTG	1 cut(s)	238
Cfr13I	GGNCC	2 cut(s)	4, 141
ClaI	ATCGAT	1 cut(s)	39
Csp6I	GTAC	3 cut(s)	48, 155, 312
CviAII	CATG	2 cut(s)	103, 167
CviJI	RGCY	7 cut(s)	6, 79, 107, 182, 218, 224, 281
CviKI_1	RGCY	7 cut(s)	6, 79, 107, 182, 218, 224, 281
CviQI	GTAC	3 cut(s)	48, 155, 312
DdeI	CTNAG	1 cut(s)	220
DpnI	GATC	2 cut(s)	38, 84
DpnII	GATC	2 cut(s)	36, 82
DriI	GACNNNNNGTC	1 cut(s)	147
EaeI	YGGCCR	1 cut(s)	105
Eam1105I	GACNNNNNGTC	1 cut(s)	147
Ecl136II	GAGCTC	1 cut(s)	79
Eco105I	TACGTA	1 cut(s)	315
Eco130I	CCWWGG	1 cut(s)	137
Eco24I	GRGCYC	1 cut(s)	81
Eco47I	GGWCC	1 cut(s)	141
Eco53kI	GAGCTC	1 cut(s)	79
Eco57I	CTGAAG	1 cut(s)	204
EcoICRI	GAGCTC	1 cut(s)	79
EcoO109I	RGGNCCY	1 cut(s)	141
EcoT14I	CCWWGG	1 cut(s)	137
EcoT22I	ATGCAT	1 cut(s)	22
EcoT38I	GRGCYC	1 cut(s)	81
ErhI	CCWWGG	1 cut(s)	137
FaeI	CATG	2 cut(s)	106, 170
FaiI	YATR	8 cut(s)	14, 16, 18, 104, 168, 274, 284, 308
FatI	CATG	2 cut(s)	102, 166
FokI	GGATG	1 cut(s)	252
FriOI	GRGCYC	1 cut(s)	81
FspBI	CTAG	4 cut(s)	138, 171, 278, 296
HaeIII	GGCC	2 cut(s)	6, 107
Hin1II	CATG	2 cut(s)	106, 170
HinfI	GANTC	3 cut(s)	148, 206, 299
Hpy166II	GTNNAC	1 cut(s)	260
Hpy188I	TCNGA	1 cut(s)	198
Hpy8I	GTNNAC	1 cut(s)	260
HpyCH4III	ACNGT	1 cut(s)	112
HpyCH4IV	ACGT	1 cut(s)	314
HpyCH4V	TGCA	1 cut(s)	20
HpyF3I	CTNAG	1 cut(s)	220
HpySE526I	ACGT	1 cut(s)	314
Hsp92II	CATG	2 cut(s)	106, 170
Kzo9I	GATC	2 cut(s)	36, 82
LmnI	GCTCC	1 cut(s)	125
LpnPI	CCDG	2 cut(s)	20, 42
LweI	GCATC	2 cut(s)	29, 274
MaeI	CTAG	4 cut(s)	138, 171, 278, 296
MaeII	ACGT	1 cut(s)	314
MalI	GATC	2 cut(s)	38, 84
MboI	GATC	2 cut(s)	36, 82
MboII	GAAGA	1 cut(s)	197
MhlI	GDGCHC	1 cut(s)	81
MlsI	TGGCCA	1 cut(s)	107
MluCI	AATT	1 cut(s)	71
MluNI	TGGCCA	1 cut(s)	107
MlyI	GAGTC	1 cut(s)	157
MnlI	CCTC	2 cut(s)	229, 229
Mox20I	TGGCCA	1 cut(s)	107
Mph1103I	ATGCAT	1 cut(s)	22
MscI	TGGCCA	1 cut(s)	107
MslI	CAYNNNNRTG	1 cut(s)	128
Msp20I	TGGCCA	1 cut(s)	107
MspA1I	CMGCKG	1 cut(s)	56
NdeII	GATC	2 cut(s)	36, 82
NlaIII	CATG	2 cut(s)	106, 170
NlaIV	GGNNCC	1 cut(s)	135
NsiI	ATGCAT	1 cut(s)	22
PfeI	GAWTC	2 cut(s)	206, 299
PleI	GAGTC	1 cut(s)	156
PpsI	GAGTC	1 cut(s)	156
Ppu21I	YACGTR	1 cut(s)	315
PpuMI	RGGWCCY	1 cut(s)	141
Psp124BI	GAGCTC	1 cut(s)	81
Psp5II	RGGWCCY	1 cut(s)	141
PspN4I	GGNNCC	1 cut(s)	135
PspPI	GGNCC	2 cut(s)	4, 141
PspPPI	RGGWCCY	1 cut(s)	141
RsaI	GTAC	3 cut(s)	49, 156, 313
RsaNI	GTAC	3 cut(s)	48, 155, 312
RseI	CAYNNNNRTG	1 cut(s)	128
SacI	GAGCTC	1 cut(s)	81
Sau3AI	GATC	2 cut(s)	36, 82
Sau96I	GGNCC	2 cut(s)	4, 141
SchI	GAGTC	1 cut(s)	157
SduI	GDGCHC	1 cut(s)	81
SetI	ASST	8 cut(s)	81, 139, 146, 226, 240, 283, 297, 317
SfaNI	GCATC	2 cut(s)	29, 274
SinI	GGWCC	1 cut(s)	141
SmiMI	CAYNNNNRTG	1 cut(s)	128
SmlI	CTYRAG	1 cut(s)	145
SmoI	CTYRAG	1 cut(s)	145
SnaBI	TACGTA	1 cut(s)	315
Sse9I	AATT	1 cut(s)	71
SsiI	CCGC	1 cut(s)	54
SspMI	CTAG	4 cut(s)	138, 171, 278, 296
SstI	GAGCTC	1 cut(s)	81
StyI	CCWWGG	1 cut(s)	137
TaaI	ACNGT	1 cut(s)	112
TaiI	ACGT	1 cut(s)	317
TaqI	TCGA	2 cut(s)	39, 81
TasI	AATT	1 cut(s)	71
TatI	WGTACW	1 cut(s)	154
TfiI	GAWTC	2 cut(s)	206, 299
TscAI	CASTG	1 cut(s)	238
TspDTI	ATGAA	2 cut(s)	91, 299
TspRI	CASTG	1 cut(s)	238
VpaK11BI	GGWCC	1 cut(s)	141
XapI	RAATTY	1 cut(s)	71
XmaJI	CCTAGG	1 cut(s)	137
XspI	CTAG	4 cut(s)	138, 171, 278, 296
Zsp2I	ATGCAT	1 cut(s)	22

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.