Rmu_sc0013099.1_g000005

No description available

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0013099.1
Physical Location & Seq
Reverse (-)
19520 .. 20627
1108 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0013099.1_g000005.1.cds

Sequence Viewer

Length: 336 bp
atggccaaagtttgttgctccattgagatggaacctaggaccttgagtcaagtacaactcaaccatgctagggaaatggctgaagatgtggttcagaaaatggaatcaaacgaagcctcagctacattcagtgagggattgagaccgattggttcagagacacaggtggaccatgtaaatattgctgaagcgggtgaagaaccacagaataagctaattctggagtcggaggaggctcaactgtatgaaagatcatgccaatgcttgtgtgctgctgccaatattgaaaccccagatcaagaaaagcttaaggaacccctctcggccccattttga
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

111

Amino Acids

12.29

Weight (kDa)

4.44

Isoelectric Point (pI)

67.62

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 191
AcoI YGGCCR 1 cut(s) 3
AcuI CTGAAG 2 cut(s) 102, 207
AfaI GTAC 1 cut(s) 54
AfiI CCNNNNNNNGG 1 cut(s) 70
AflII CTTAAG 1 cut(s) 308
AgsI TTSAA 1 cut(s) 287
AhdI GACNNNNNGTC 1 cut(s) 45
AluBI AGCT 3 cut(s) 122, 214, 307
AluI AGCT 3 cut(s) 122, 214, 307
Alw26I GTCTC 2 cut(s) 136, 152
AoxI GGCC 2 cut(s) 3, 324
ApeKI GCWGC 2 cut(s) 272, 275
AspA2I CCTAGG 1 cut(s) 35
AspS9I GGNCC 3 cut(s) 39, 169, 325
AsuHPI GGTGA 1 cut(s) 206
AvaII GGWCC 2 cut(s) 39, 169
AvrII CCTAGG 1 cut(s) 35
BalI TGGCCA 1 cut(s) 5
BbvCI CCTCAGC 1 cut(s) 118
BbvI GCAGC 2 cut(s) 259, 262
BccI CCATC 1 cut(s) 22
BcoDI GTCTC 2 cut(s) 136, 152
BfaI CTAG 2 cut(s) 36, 69
BfrI CTTAAG 1 cut(s) 308
BisI GCNGC 2 cut(s) 273, 276
BlnI CCTAGG 1 cut(s) 35
BlsI GCNGC 2 cut(s) 274, 277
Bme18I GGWCC 2 cut(s) 39, 169
BmeRI GACNNNNNGTC 1 cut(s) 45
BmgT120I GGNCC 3 cut(s) 39, 169, 325
BmiI GGNNCC 3 cut(s) 33, 315, 327
BpmI CTGGAG 1 cut(s) 242
Bpu10I CCTNAGC 1 cut(s) 118
BpuEI CTTGAG 1 cut(s) 64
BsaI GGTCTC 1 cut(s) 136
BsaJI CCNNGG 1 cut(s) 35
Bsc4I CCNNNNNNNGG 1 cut(s) 70
BseDI CCNNGG 1 cut(s) 35
BseLI CCNNNNNNNGG 1 cut(s) 70
BseMII CTCAG 1 cut(s) 132
BseRI GAGGAG 1 cut(s) 245
BseXI GCAGC 2 cut(s) 259, 262
BshFI GGCC 2 cut(s) 5, 326
BslI CCNNNNNNNGG 1 cut(s) 70
BsmAI GTCTC 2 cut(s) 136, 152
BsnI GGCC 2 cut(s) 5, 326
Bso31I GGTCTC 1 cut(s) 136
Bsp143I GATC 2 cut(s) 251, 295
BspACI CCGC 1 cut(s) 191
BspANI GGCC 2 cut(s) 5, 326
BspCNI CTCAG 1 cut(s) 131
BspLI GGNNCC 3 cut(s) 33, 315, 327
BspTI CTTAAG 1 cut(s) 308
BspTNI GGTCTC 1 cut(s) 136
BssECI CCNNGG 1 cut(s) 35
BssMI GATC 2 cut(s) 251, 295
BssT1I CCWWGG 1 cut(s) 35
Bst4CI ACNGT 1 cut(s) 243
BstAFI CTTAAG 1 cut(s) 308
BstDEI CTNAG 1 cut(s) 118
BstKTI GATC 2 cut(s) 254, 298
BstMAI GTCTC 2 cut(s) 136, 152
BstMBI GATC 2 cut(s) 251, 295
BstV1I GCAGC 2 cut(s) 259, 262
BstXI CCANNNNNNTGG 1 cut(s) 28
BsuRI GGCC 2 cut(s) 5, 326
BtsIMutI CAGTG 1 cut(s) 136
Cfr13I GGNCC 3 cut(s) 39, 169, 325
Csp6I GTAC 1 cut(s) 53
CviAII CATG 3 cut(s) 65, 173, 255
CviJI RGCY 8 cut(s) 5, 80, 116, 122, 214, 236, 307, 326
CviKI_1 RGCY 8 cut(s) 5, 80, 116, 122, 214, 236, 307, 326
CviQI GTAC 1 cut(s) 53
DdeI CTNAG 1 cut(s) 118
DpnI GATC 2 cut(s) 253, 297
DpnII GATC 2 cut(s) 251, 295
DriI GACNNNNNGTC 1 cut(s) 45
EaeI YGGCCR 1 cut(s) 3
Eam1105I GACNNNNNGTC 1 cut(s) 45
Eco130I CCWWGG 1 cut(s) 35
Eco31I GGTCTC 1 cut(s) 136
Eco47I GGWCC 2 cut(s) 39, 169
Eco57I CTGAAG 2 cut(s) 102, 207
EcoO109I RGGNCCY 1 cut(s) 39
EcoT14I CCWWGG 1 cut(s) 35
ErhI CCWWGG 1 cut(s) 35
FaeI CATG 3 cut(s) 68, 176, 258
FaiI YATR 4 cut(s) 66, 174, 246, 256
FalI AAGNNNNNCTT 2 cut(s) 291, 323
FatI CATG 3 cut(s) 64, 172, 254
FauI CCCGC 1 cut(s) 184
Fnu4HI GCNGC 2 cut(s) 273, 276
Fsp4HI GCNGC 2 cut(s) 273, 276
FspBI CTAG 2 cut(s) 36, 69
GluI GCNGC 2 cut(s) 273, 276
GsuI CTGGAG 1 cut(s) 242
HaeIII GGCC 2 cut(s) 5, 326
Hin1II CATG 3 cut(s) 68, 176, 258
HindIII AAGCTT 1 cut(s) 305
HinfI GANTC 3 cut(s) 46, 104, 224
HphI GGTGA 1 cut(s) 206
Hpy166II GTNNAC 1 cut(s) 169
Hpy188I TCNGA 3 cut(s) 96, 157, 229
Hpy188III TCNNGA 2 cut(s) 221, 299
Hpy8I GTNNAC 1 cut(s) 169
HpyCH4III ACNGT 1 cut(s) 243
HpyF3I CTNAG 1 cut(s) 118
Hsp92II CATG 3 cut(s) 68, 176, 258
Kzo9I GATC 2 cut(s) 251, 295
LmnI GCTCC 1 cut(s) 23
LpnPI CCDG 3 cut(s) 149, 206, 306
Lsp1109I GCAGC 2 cut(s) 259, 262
MaeI CTAG 2 cut(s) 36, 69
MalI GATC 2 cut(s) 253, 297
MboI GATC 2 cut(s) 251, 295
MboII GAAGA 2 cut(s) 95, 209
MlsI TGGCCA 1 cut(s) 5
MluCI AATT 1 cut(s) 216
MluNI TGGCCA 1 cut(s) 5
MlyI GAGTC 2 cut(s) 55, 233
MmeI TCCRAC 1 cut(s) 207
MnlI CCTC 5 cut(s) 127, 127, 223, 226, 329
Mox20I TGGCCA 1 cut(s) 5
MscI TGGCCA 1 cut(s) 5
MseI TTAA 1 cut(s) 309
MslI CAYNNNNRTG 2 cut(s) 26, 259
Msp20I TGGCCA 1 cut(s) 5
MspCI CTTAAG 1 cut(s) 308
NdeII GATC 2 cut(s) 251, 295
NlaIII CATG 3 cut(s) 68, 176, 258
NlaIV GGNNCC 3 cut(s) 33, 315, 327
NmeAIII GCCGAG 1 cut(s) 302
PfeI GAWTC 1 cut(s) 104
PkrI GCNGC 2 cut(s) 274, 277
PleI GAGTC 2 cut(s) 54, 232
PpsI GAGTC 2 cut(s) 54, 232
PpuMI RGGWCCY 1 cut(s) 39
Psp5II RGGWCCY 1 cut(s) 39
PspN4I GGNNCC 3 cut(s) 33, 315, 327
PspPI GGNCC 3 cut(s) 39, 169, 325
PspPPI RGGWCCY 1 cut(s) 39
RsaI GTAC 1 cut(s) 54
RsaNI GTAC 1 cut(s) 53
RseI CAYNNNNRTG 2 cut(s) 26, 259
SaqAI TTAA 1 cut(s) 309
SatI GCNGC 2 cut(s) 273, 276
Sau3AI GATC 2 cut(s) 251, 295
Sau96I GGNCC 3 cut(s) 39, 169, 325
SchI GAGTC 2 cut(s) 55, 233
SetI ASST 6 cut(s) 37, 44, 124, 168, 216, 309
SinI GGWCC 2 cut(s) 39, 169
SmiMI CAYNNNNRTG 2 cut(s) 26, 259
SmlI CTYRAG 2 cut(s) 43, 308
SmoI CTYRAG 2 cut(s) 43, 308
Sse9I AATT 1 cut(s) 216
SsiI CCGC 1 cut(s) 191
SspI AATATT 2 cut(s) 181, 283
SspMI CTAG 2 cut(s) 36, 69
StyI CCWWGG 1 cut(s) 35
TaaI ACNGT 1 cut(s) 243
TaqII GACCGA 1 cut(s) 160
TasI AATT 1 cut(s) 216
TatI WGTACW 1 cut(s) 52
TfiI GAWTC 1 cut(s) 104
Tru1I TTAA 1 cut(s) 309
Tru9I TTAA 1 cut(s) 309
TscAI CASTG 1 cut(s) 136
TseI GCWGC 2 cut(s) 272, 275
TspDTI ATGAA 1 cut(s) 261
TspRI CASTG 1 cut(s) 136
Vha464I CTTAAG 1 cut(s) 308
VpaK11BI GGWCC 2 cut(s) 39, 169
XmaJI CCTAGG 1 cut(s) 35
XspI CTAG 2 cut(s) 36, 69
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.