Basic Information

Type: gene

Biological Identity

Species

malus_domestica

Chromosome

Chr10

Orthogroup ID

OG0010453

Physical Location & Seq

Genomic Coordinates Forward (+)

19580216 .. 19581471

Gene Structure 1256 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

MD10G1118400.v1.1.491

Sequence Viewer

CDS Protein Promoter (2k)

Length: 126 bp

ATGAAAACCAAGAGGGCTCCCAAGGTGGAAGTTGGAACCAAGGCTACCGATGCCTCTATGGATGAATGGCTTCAGGGAACTGCATATACTCAGTCAGTCAAAGACAAAACAAAAAAGAAGAAATAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005773 GO:0005774 GO:0005783 GO:0005789 GO:0005794 GO:0005886 GO:0006605 GO:0006612 GO:0006613 GO:0006810 GO:0006886 GO:0008104 GO:0008150 GO:0009507 GO:0009534 GO:0009535 GO:0009536 GO:0009579 GO:0012505 GO:0015031 GO:0015833 GO:0016020 GO:0031090 GO:0031976 GO:0031984 GO:0033036 GO:0034357 GO:0034613 GO:0042175 GO:0042651 GO:0042886 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0044422 GO:0044424 GO:0044425 GO:0044432 GO:0044434 GO:0044435 GO:0044436 GO:0044437 GO:0044444 GO:0044446 GO:0044464 GO:0045184 GO:0046907 GO:0051179 GO:0051234 GO:0051641 GO:0051649 GO:0055035 GO:0070727 GO:0071702 GO:0071705 GO:0071944 GO:0072657 GO:0090150 GO:0098588 GO:0098805 GO:0098827

KEGG Pathways

Metabolic & Signaling

ko04141 map04141

Pfam Domains

Protein Families

TRAP_alpha

Protein Analysis

42

Amino Acids

4.61

Weight (kDa)

9.92

Isoelectric Point (pI)

25.45

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0010453)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G21160 AT2G21160
fragaria_vesca	FvH4_2g01990 FvH4_2g01990
malus_domestica	MD10G1118300.v1.1 MD10G1118400.v1.1
prunus_persica	Prupe.8G160800_v2.0.a1
pyrus_communis	pycom10g10220 pycom10g10230 pycom10g10240
rosa_chinensis	RchiOBHm_Chr6g0245171
rosa_laevigata	RLG00000015319
rosa_multiflora	Rmu_sc0001288.1_g000003 Rmu_sc0015012.1_g000002
rosa_roxburghii	Rroxscaffold_7G00215390
rosa_rugosa	Rorug05G0512500
rosa_samantha	Rh6AG027600 Rh6BG023700 Rh6CG022100 Rh6DG022200
rosa_wichuraiana	Rw6G002330

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AcuI	CTGAAG	1 cut(s)	56
Asp700I	GAANNNNTTC	1 cut(s)	69
BanII	GRGCYC	1 cut(s)	19
BmiI	GGNNCC	2 cut(s)	18, 37
BmsI	GCATC	1 cut(s)	40
BsaJI	CCNNGG	2 cut(s)	21, 39
BseDI	CCNNGG	2 cut(s)	21, 39
BseGI	GGATG	1 cut(s)	67
BseMII	CTCAG	1 cut(s)	104
Bsp1286I	GDGCHC	1 cut(s)	19
BspCNI	CTCAG	1 cut(s)	103
BspLI	GGNNCC	2 cut(s)	18, 37
BssECI	CCNNGG	2 cut(s)	21, 39
BssT1I	CCWWGG	2 cut(s)	21, 39
BstDEI	CTNAG	1 cut(s)	90
BstF5I	GGATG	1 cut(s)	67
BstMWI	GCNNNNNNNGC	1 cut(s)	50
BtsCI	GGATG	1 cut(s)	67
CviJI	RGCY	3 cut(s)	17, 44, 70
CviKI_1	RGCY	3 cut(s)	17, 44, 70
DdeI	CTNAG	1 cut(s)	90
Eco130I	CCWWGG	2 cut(s)	21, 39
Eco24I	GRGCYC	1 cut(s)	19
Eco57I	CTGAAG	1 cut(s)	56
EcoT14I	CCWWGG	2 cut(s)	21, 39
EcoT38I	GRGCYC	1 cut(s)	19
ErhI	CCWWGG	2 cut(s)	21, 39
FaiI	YATR	3 cut(s)	59, 85, 87
FokI	GGATG	1 cut(s)	74
FriOI	GRGCYC	1 cut(s)	19
HpyCH4V	TGCA	1 cut(s)	83
HpyF10VI	GCNNNNNNNGC	1 cut(s)	50
HpyF3I	CTNAG	1 cut(s)	90
LmnI	GCTCC	1 cut(s)	22
LpnPI	CCDG	1 cut(s)	59
LweI	GCATC	1 cut(s)	40
MhlI	GDGCHC	1 cut(s)	19
MmeI	TCCRAC	1 cut(s)	13
MnlI	CCTC	2 cut(s)	6, 64
MroXI	GAANNNNTTC	1 cut(s)	69
MwoI	GCNNNNNNNGC	1 cut(s)	50
NlaIV	GGNNCC	2 cut(s)	18, 37
PdmI	GAANNNNTTC	1 cut(s)	69
PspN4I	GGNNCC	2 cut(s)	18, 37
PsrI	GAACNNNNNNTAC	4 cut(s)	28, 60, 70, 102
SduI	GDGCHC	1 cut(s)	19
SetI	ASST	1 cut(s)	27
SfaNI	GCATC	1 cut(s)	40
SgeI	CNNG	4 cut(s)	22, 34, 52, 86
StyI	CCWWGG	2 cut(s)	21, 39
TspDTI	ATGAA	2 cut(s)	17, 78
XmnI	GAANNNNTTC	1 cut(s)	69

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.