MD11G1314300.v1.1

ABC transporter C family member

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr11
Physical Location & Seq
Forward (+)
42666045 .. 42666634
590 bp
Loading structure...
UTR
Exon/CDS
Intron
MD11G1314300.v1.1.491

Sequence Viewer

Length: 144 bp
ATGCCTGGGAGTTTACTTTTCTGCATTTCCACTATGTTCATGATCTTGTTGCCAAGCAGTATTATAAAGCCAGAGAATGTTGGTTTAACTGTCTCCTACGGACTGTCCCTTAATGGTGTGCTGTTCTGGGGTCATATATTTTAG

Protein Analysis

48

Amino Acids

5.15

Weight (kDa)

6.5

Isoelectric Point (pI)

36.15

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 65
AjnI CCWGG 1 cut(s) 4
Alw26I GTCTC 1 cut(s) 97
BciT130I CCWGG 1 cut(s) 6
BcoDI GTCTC 1 cut(s) 97
Bme1390I CCNGG 1 cut(s) 6
BmrFI CCNGG 1 cut(s) 6
BsaJI CCNNGG 1 cut(s) 5
BseBI CCWGG 1 cut(s) 6
BseDI CCNNGG 1 cut(s) 5
BslFI GGGAC 1 cut(s) 91
BsmAI GTCTC 1 cut(s) 97
BsmFI GGGAC 1 cut(s) 91
Bsp143I GATC 1 cut(s) 42
BspHI TCATGA 1 cut(s) 39
BssECI CCNNGG 1 cut(s) 5
BssMI GATC 1 cut(s) 42
Bst2UI CCWGG 1 cut(s) 6
Bst4CI ACNGT 2 cut(s) 91, 105
BstKTI GATC 1 cut(s) 45
BstMAI GTCTC 1 cut(s) 97
BstMBI GATC 1 cut(s) 42
BstNI CCWGG 1 cut(s) 6
BstSCI CCNGG 1 cut(s) 4
CciI TCATGA 1 cut(s) 39
CviAII CATG 1 cut(s) 40
CviJI RGCY 1 cut(s) 70
CviKI_1 RGCY 1 cut(s) 70
DpnI GATC 1 cut(s) 44
DpnII GATC 1 cut(s) 42
EcoRII CCWGG 1 cut(s) 4
FaeI CATG 1 cut(s) 43
FaiI YATR 5 cut(s) 35, 41, 65, 135, 137
FaqI GGGAC 1 cut(s) 91
FatI CATG 1 cut(s) 39
Hin1II CATG 1 cut(s) 43
Hpy166II GTNNAC 1 cut(s) 14
Hpy188III TCNNGA 1 cut(s) 40
Hpy8I GTNNAC 1 cut(s) 14
HpyCH4III ACNGT 2 cut(s) 91, 105
HpyCH4V TGCA 1 cut(s) 24
Hsp92II CATG 1 cut(s) 43
Kzo9I GATC 1 cut(s) 42
LpnPI CCDG 3 cut(s) 18, 84, 112
MalI GATC 1 cut(s) 44
MboI GATC 1 cut(s) 42
MseI TTAA 2 cut(s) 86, 111
MspR9I CCNGG 1 cut(s) 6
MvaI CCWGG 1 cut(s) 6
NdeII GATC 1 cut(s) 42
NlaIII CATG 1 cut(s) 43
PagI TCATGA 1 cut(s) 39
PsiI TTATAA 1 cut(s) 65
Psp6I CCWGG 1 cut(s) 4
PspGI CCWGG 1 cut(s) 4
SaqAI TTAA 2 cut(s) 86, 111
Sau3AI GATC 1 cut(s) 42
ScrFI CCNGG 1 cut(s) 6
SgeI CNNG 7 cut(s) 17, 18, 52, 58, 66, 83, 139
StyD4I CCNGG 1 cut(s) 4
TaaI ACNGT 2 cut(s) 91, 105
Tru1I TTAA 2 cut(s) 86, 111
Tru9I TTAA 2 cut(s) 86, 111
TspDTI ATGAA 1 cut(s) 28
TspGWI ACGGA 1 cut(s) 114
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.