MD12G1083300.v1.1

Proteasome-associated protein ECM29 homolog

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr12
OG0006358
Physical Location & Seq
Reverse (-)
10110180 .. 10115869
5690 bp
Loading structure...
UTR
Exon/CDS
Intron
MD12G1083300.v1.1.491

Sequence Viewer

Length: 540 bp
ATGACTAAAAAGTATAATATTAAATGTAATATAATAATTATTTTATTTTTTATTTATAATTTCATCCACGATCTTCATCAGTTTCTGGTCACAGCTCAAGATCCAAATCCCTCCCCTCCAACCCTCTGTTCCCTCCCCTTCCCAATCACCAAAATCGCCGATCCTCGAGAGAGAGAGAGCAAGAAATTCCGAGCTTCCGAATCTCTCGAACTCCATGATCGGATTCCAATCAGCCAATCCATCCAATCAATTTTGAAAAAACCCAGAAAAAAACAAAGAAAAAAAGGGGATGTGAAAGAAATGGCGGAAGCATCATCGGCGTCTGCGACAAAGTGGGATGAAGAGAAAGTAGAGATGCTGGACCAATTGCTAACTCGGCTAGCTCTCTGCGATGACTCCAACCTCCAACCCTTACTCTCCAAGCTTCTCCGCCTCACCATTTCCTCCCTTTCTTCTCAATCCTCCGCCGTCCGCAACAAGACACTTCAATCACAAGCTTGGTCCAATGCCAAAAACAGAAACAAATCATTCAACCAGTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
Ecm29

Protein Analysis

180

Amino Acids

20.5

Weight (kDa)

9.74

Isoelectric Point (pI)

55.18

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
ECM29_N PF13001 120 - 163 8.3e-06 Proteasome component ECM29, N-terminal
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 57
AciI CCGC 4 cut(s) 305, 430, 465, 472
AclWI GGATC 2 cut(s) 95, 155
AcsI RAATTY 1 cut(s) 185
AcyI GRCGYC 1 cut(s) 320
AgsI TTSAA 3 cut(s) 256, 488, 532
AjuI GAANNNNNNNTTGG 2 cut(s) 112, 144
AluBI AGCT 5 cut(s) 95, 194, 383, 424, 497
AluI AGCT 5 cut(s) 95, 194, 383, 424, 497
AlwI GGATC 2 cut(s) 95, 155
AlwNI CAGNNNCTG 1 cut(s) 85
Ama87I CYCGRG 1 cut(s) 165
ApoI RAATTY 1 cut(s) 185
AspS9I GGNCC 2 cut(s) 361, 501
AsuHPI GGTGA 2 cut(s) 139, 427
AsuNHI GCTAGC 1 cut(s) 379
AvaI CYCGRG 1 cut(s) 165
AvaII GGWCC 2 cut(s) 361, 501
BccI CCATC 1 cut(s) 248
BceAI ACGGC 1 cut(s) 452
BfaI CTAG 1 cut(s) 380
Bme18I GGWCC 2 cut(s) 361, 501
BmeT110I CYCGRG 1 cut(s) 165
BmgT120I GGNCC 2 cut(s) 361, 501
BmsI GCATC 2 cut(s) 320, 345
BmtI GCTAGC 1 cut(s) 383
BpuEI CTTGAG 1 cut(s) 81
BsaBI GATNNNNATC 3 cut(s) 75, 105, 227
BsaHI GRCGYC 1 cut(s) 320
Bse1I ACTGG 1 cut(s) 535
Bse8I GATNNNNATC 3 cut(s) 75, 105, 227
BseGI GGATG 4 cut(s) 63, 240, 295, 343
BseJI GATNNNNATC 3 cut(s) 75, 105, 227
BseNI ACTGG 1 cut(s) 535
BsiHKCI CYCGRG 1 cut(s) 165
BsoBI CYCGRG 1 cut(s) 165
Bsp143I GATC 4 cut(s) 70, 100, 160, 217
BspACI CCGC 4 cut(s) 305, 430, 465, 472
BspOI GCTAGC 1 cut(s) 383
BspPI GGATC 2 cut(s) 95, 155
BsrI ACTGG 1 cut(s) 535
BssMI GATC 4 cut(s) 70, 100, 160, 217
BssNI GRCGYC 1 cut(s) 320
Bst6I CTCTTC 1 cut(s) 336
BstACI GRCGYC 1 cut(s) 320
BstC8I GCNNGC 1 cut(s) 381
BstF5I GGATG 4 cut(s) 63, 240, 295, 343
BstKTI GATC 4 cut(s) 73, 103, 163, 220
BstMBI GATC 4 cut(s) 70, 100, 160, 217
BstMWI GCNNNNNNNGC 2 cut(s) 317, 376
BstX2I RGATCY 1 cut(s) 100
BstYI RGATCY 1 cut(s) 100
BtgZI GCGATG 1 cut(s) 405
BtsCI GGATG 4 cut(s) 63, 240, 295, 343
Cac8I GCNNGC 1 cut(s) 381
CaiI CAGNNNCTG 1 cut(s) 85
Cfr13I GGNCC 2 cut(s) 361, 501
CseI GACGC 1 cut(s) 309
CviAII CATG 1 cut(s) 215
CviJI RGCY 7 cut(s) 95, 194, 234, 379, 383, 424, 497
CviKI_1 RGCY 7 cut(s) 95, 194, 234, 379, 383, 424, 497
DpnI GATC 4 cut(s) 72, 102, 162, 219
DpnII GATC 4 cut(s) 70, 100, 160, 217
Eam1104I CTCTTC 1 cut(s) 336
EarI CTCTTC 1 cut(s) 336
EciI GGCGGA 3 cut(s) 320, 419, 454
Eco47I GGWCC 2 cut(s) 361, 501
Eco88I CYCGRG 1 cut(s) 165
FaeI CATG 1 cut(s) 218
FaiI YATR 4 cut(s) 15, 32, 57, 216
FatI CATG 1 cut(s) 214
FokI GGATG 4 cut(s) 50, 227, 302, 350
FspBI CTAG 1 cut(s) 380
HgaI GACGC 1 cut(s) 309
Hin1I GRCGYC 1 cut(s) 320
Hin1II CATG 1 cut(s) 218
HindIII AAGCTT 2 cut(s) 422, 495
HinfI GANTC 3 cut(s) 200, 223, 395
HphI GGTGA 2 cut(s) 139, 427
Hpy188I TCNGA 3 cut(s) 191, 199, 222
Hpy188III TCNNGA 3 cut(s) 98, 167, 206
HpyAV CCTTC 1 cut(s) 148
HpyF10VI GCNNNNNNNGC 2 cut(s) 317, 376
Hsp92I GRCGYC 1 cut(s) 320
Hsp92II CATG 1 cut(s) 218
Kzo9I GATC 4 cut(s) 70, 100, 160, 217
LpnPI CCDG 3 cut(s) 71, 277, 344
LweI GCATC 2 cut(s) 320, 345
MaeI CTAG 1 cut(s) 380
MaeIII GTNAC 1 cut(s) 88
MalI GATC 4 cut(s) 72, 102, 162, 219
MboI GATC 4 cut(s) 70, 100, 160, 217
MboII GAAGA 3 cut(s) 65, 353, 444
MfeI CAATTG 1 cut(s) 365
MflI RGATCY 1 cut(s) 100
MluCI AATT 5 cut(s) 36, 58, 185, 249, 365
MlyI GAGTC 1 cut(s) 389
MmeI TCCRAC 3 cut(s) 143, 423, 430
MnlI CCTC 9 cut(s) 121, 126, 134, 143, 174, 413, 443, 454, 472
MseI TTAA 1 cut(s) 21
MunI CAATTG 1 cut(s) 365
MwoI GCNNNNNNNGC 2 cut(s) 317, 376
NdeII GATC 4 cut(s) 70, 100, 160, 217
NheI GCTAGC 1 cut(s) 379
NlaIII CATG 1 cut(s) 218
NmeAIII GCCGAG 1 cut(s) 355
NmuCI GTSAC 1 cut(s) 88
PaeR7I CTCGAG 1 cut(s) 165
PcsI WCGNNNNNNNCGW 1 cut(s) 323
PfeI GAWTC 2 cut(s) 200, 223
PleI GAGTC 1 cut(s) 389
PpsI GAGTC 1 cut(s) 389
PsiI TTATAA 1 cut(s) 57
PspPI GGNCC 2 cut(s) 361, 501
PstNI CAGNNNCTG 1 cut(s) 85
PsuI RGATCY 1 cut(s) 100
SaqAI TTAA 1 cut(s) 21
Sau3AI GATC 4 cut(s) 70, 100, 160, 217
Sau96I GGNCC 2 cut(s) 361, 501
SchI GAGTC 1 cut(s) 389
SetI ASST 6 cut(s) 97, 196, 385, 405, 426, 499
SfaNI GCATC 2 cut(s) 320, 345
Sfr274I CTCGAG 1 cut(s) 165
SinI GGWCC 2 cut(s) 361, 501
SlaI CTCGAG 1 cut(s) 165
SmlI CTYRAG 2 cut(s) 96, 165
SmoI CTYRAG 2 cut(s) 96, 165
Sse9I AATT 5 cut(s) 36, 58, 185, 249, 365
SsiI CCGC 4 cut(s) 305, 430, 465, 472
SspI AATATT 1 cut(s) 19
SspMI CTAG 1 cut(s) 380
TaqI TCGA 2 cut(s) 166, 207
TasI AATT 5 cut(s) 36, 58, 185, 249, 365
TfiI GAWTC 2 cut(s) 200, 223
Tru1I TTAA 1 cut(s) 21
Tru9I TTAA 1 cut(s) 21
TseFI GTSAC 1 cut(s) 88
Tsp45I GTSAC 1 cut(s) 88
TspDTI ATGAA 3 cut(s) 52, 65, 354
VpaK11BI GGWCC 2 cut(s) 361, 501
XapI RAATTY 1 cut(s) 185
XhoI CTCGAG 1 cut(s) 165
XspI CTAG 1 cut(s) 380
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.