Basic Information

Type: gene

Biological Identity

Species

malus_domestica

Chromosome

Chr12

Orthogroup ID

OG0010135

Physical Location & Seq

Genomic Coordinates Reverse (-)

19611367 .. 19612492

Gene Structure 1126 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

MD12G1122100.v1.1.491

Sequence Viewer

CDS Protein Promoter (2k)

Length: 189 bp

ATGGATACTGAGGTTTATGAAATCGATTATAGAGGTCCGGAGACTCACTCATCAGTTCCATCACCTGGTCACTCTTACGGGAAGAAGTCTTTGCCTTTGATCCACAAAGAAAATGCCATGGCAACCCCAAAACCTAATAGCATTGAAGGTGCTAACATGGGAAGAAAGGTGAAGAAAGTACATGGATGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

63

Amino Acids

6.8

Weight (kDa)

9.05

Isoelectric Point (pI)

34.1

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0010135)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT5G03120 AT5G03120
fragaria_vesca	FvH4_6g15530
malus_domestica	MD04G1102400.v1.1 MD12G1122100.v1.1
prunus_persica	Prupe.6G240500_v2.0.a1 Prupe.6G240500_v2.0.a1
pyrus_communis	pycom04g09770 pycom12g12110
rosa_chinensis	RchiOBHm_Chr3g0469031
rosa_laevigata	RLG00000024389
rosa_multiflora	Rmu_sc0000326.1_g000004
rosa_roxburghii	Rroxscaffold_6G00412310
rosa_rugosa	Rorug03G0098600 Rorug03G0098700 Rorug03G0098700
rosa_samantha	Rh3AG148000 Rh3BG170800 Rh3DG204300
rosa_wichuraiana	Rw0G010960 Rw3G013960

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AccB7I	CCANNNNNTGG	1 cut(s)	65
AccIII	TCCGGA	1 cut(s)	37
AclWI	GGATC	1 cut(s)	94
AfaI	GTAC	1 cut(s)	180
AfiI	CCNNNNNNNGG	1 cut(s)	65
AgsI	TTSAA	1 cut(s)	146
AjnI	CCWGG	1 cut(s)	64
Alw26I	GTCTC	1 cut(s)	35
AlwI	GGATC	1 cut(s)	94
Aor13HI	TCCGGA	1 cut(s)	37
AspS9I	GGNCC	1 cut(s)	35
AsuHPI	GGTGA	2 cut(s)	54, 181
AvaII	GGWCC	1 cut(s)	35
BaeI	ACNNNNGTAYC	1 cut(s)	30
BccI	CCATC	1 cut(s)	67
BciT130I	CCWGG	1 cut(s)	66
BcoDI	GTCTC	1 cut(s)	35
Bme1390I	CCNGG	1 cut(s)	66
Bme18I	GGWCC	1 cut(s)	35
BmgT120I	GGNCC	1 cut(s)	35
BmrFI	CCNGG	1 cut(s)	66
BplI	GAGNNNNNCTC	2 cut(s)	32, 64
Bsa29I	ATCGAT	1 cut(s)	24
BsaJI	CCNNGG	1 cut(s)	117
BsaWI	WCCGGW	1 cut(s)	37
Bsc4I	CCNNNNNNNGG	1 cut(s)	65
BseAI	TCCGGA	1 cut(s)	37
BseBI	CCWGG	1 cut(s)	66
BseCI	ATCGAT	1 cut(s)	24
BseDI	CCNNGG	1 cut(s)	117
BseLI	CCNNNNNNNGG	1 cut(s)	65
BshVI	ATCGAT	1 cut(s)	24
BsiSI	CCGG	1 cut(s)	38
BslI	CCNNNNNNNGG	1 cut(s)	65
BsmAI	GTCTC	1 cut(s)	35
Bsp13I	TCCGGA	1 cut(s)	37
Bsp143I	GATC	1 cut(s)	99
Bsp19I	CCATGG	1 cut(s)	117
BspDI	ATCGAT	1 cut(s)	24
BspEI	TCCGGA	1 cut(s)	37
BspPI	GGATC	1 cut(s)	94
BssECI	CCNNGG	1 cut(s)	117
BssMI	GATC	1 cut(s)	99
BssT1I	CCWWGG	1 cut(s)	117
Bst2UI	CCWGG	1 cut(s)	66
BstDEI	CTNAG	1 cut(s)	9
BstDSI	CCRYGG	1 cut(s)	117
BstKTI	GATC	1 cut(s)	102
BstMAI	GTCTC	1 cut(s)	35
BstMBI	GATC	1 cut(s)	99
BstNI	CCWGG	1 cut(s)	66
BstSCI	CCNGG	1 cut(s)	64
Bsu15I	ATCGAT	1 cut(s)	24
BsuTUI	ATCGAT	1 cut(s)	24
BtgI	CCRYGG	1 cut(s)	117
Cfr13I	GGNCC	1 cut(s)	35
ClaI	ATCGAT	1 cut(s)	24
CsiI	ACCWGGT	1 cut(s)	64
Csp6I	GTAC	1 cut(s)	179
CviAII	CATG	3 cut(s)	118, 157, 182
CviQI	GTAC	1 cut(s)	179
DdeI	CTNAG	1 cut(s)	9
DpnI	GATC	1 cut(s)	101
DpnII	GATC	1 cut(s)	99
Eco130I	CCWWGG	1 cut(s)	117
Eco47I	GGWCC	1 cut(s)	35
EcoRII	CCWGG	1 cut(s)	64
EcoT14I	CCWWGG	1 cut(s)	117
ErhI	CCWWGG	1 cut(s)	117
FaeI	CATG	3 cut(s)	121, 160, 185
FaiI	YATR	5 cut(s)	18, 30, 119, 158, 183
FatI	CATG	3 cut(s)	117, 156, 181
HapII	CCGG	1 cut(s)	38
Hin1II	CATG	3 cut(s)	121, 160, 185
HinfI	GANTC	1 cut(s)	43
HpaII	CCGG	1 cut(s)	38
HphI	GGTGA	2 cut(s)	54, 181
Hpy188III	TCNNGA	1 cut(s)	38
HpyAV	CCTTC	1 cut(s)	140
HpyF3I	CTNAG	1 cut(s)	9
Hsp92II	CATG	3 cut(s)	121, 160, 185
Kpn2I	TCCGGA	1 cut(s)	37
Kzo9I	GATC	1 cut(s)	99
LpnPI	CCDG	3 cut(s)	51, 51, 78
MabI	ACCWGGT	1 cut(s)	64
MaeIII	GTNAC	1 cut(s)	68
MalI	GATC	1 cut(s)	101
MboI	GATC	1 cut(s)	99
MboII	GAAGA	3 cut(s)	94, 174, 184
MlyI	GAGTC	1 cut(s)	37
MnlI	CCTC	2 cut(s)	4, 26
MroI	TCCGGA	1 cut(s)	37
MspI	CCGG	1 cut(s)	38
MspR9I	CCNGG	1 cut(s)	66
MvaI	CCWGG	1 cut(s)	66
NcoI	CCATGG	1 cut(s)	117
NdeII	GATC	1 cut(s)	99
NlaIII	CATG	3 cut(s)	121, 160, 185
NmuCI	GTSAC	1 cut(s)	68
PflMI	CCANNNNNTGG	1 cut(s)	65
PleI	GAGTC	1 cut(s)	37
PpsI	GAGTC	1 cut(s)	37
Psp6I	CCWGG	1 cut(s)	64
PspGI	CCWGG	1 cut(s)	64
PspPI	GGNCC	1 cut(s)	35
RsaI	GTAC	1 cut(s)	180
RsaNI	GTAC	1 cut(s)	179
Sau3AI	GATC	1 cut(s)	99
Sau96I	GGNCC	1 cut(s)	35
SchI	GAGTC	1 cut(s)	37
ScrFI	CCNGG	1 cut(s)	66
SetI	ASST	6 cut(s)	15, 37, 67, 136, 151, 171
SexAI	ACCWGGT	1 cut(s)	64
SgeI	CNNG	6 cut(s)	50, 77, 78, 91, 130, 169
SinI	GGWCC	1 cut(s)	35
StyD4I	CCNGG	1 cut(s)	64
StyI	CCWWGG	1 cut(s)	117
TaqI	TCGA	1 cut(s)	24
TatI	WGTACW	1 cut(s)	178
TseFI	GTSAC	1 cut(s)	68
Tsp45I	GTSAC	1 cut(s)	68
TspDTI	ATGAA	1 cut(s)	33
Van91I	CCANNNNNTGG	1 cut(s)	65
VpaK11BI	GGWCC	1 cut(s)	35

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.