Basic Information

Type: gene

Biological Identity

Species

malus_domestica

Chromosome

Chr14

Orthogroup ID

OG0007357

Physical Location & Seq

Genomic Coordinates Forward (+)

20073880 .. 20074338

Gene Structure 459 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

MD14G1125800.v1.1.491

Sequence Viewer

CDS Protein Promoter (2k)

Length: 162 bp

ATGGGTCTGGCGGGGCAGGGTCGCAAAGCTCTCAAACAATTCAACTTGCTCAGGGCTTTGCAGTCCGAGATACAATACGAGCTTTCCTCTAATCCCTTTCAGCAAAAGCGCTTCCAACAAAACAATTCTGAGCATTTCCAAACAAATCCTCTAGGTAGTTGA

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

GO:0003674 GO:0003676 GO:0005488 GO:0005575 GO:0005622 GO:0005623 GO:0005737 GO:0005739 GO:0005759 GO:0006091 GO:0006417 GO:0008150 GO:0008152 GO:0008494 GO:0009060 GO:0009889 GO:0009891 GO:0009893 GO:0009987 GO:0010468 GO:0010556 GO:0010557 GO:0010604 GO:0010608 GO:0010628 GO:0015980 GO:0019222 GO:0031323 GO:0031325 GO:0031326 GO:0031328 GO:0031974 GO:0032268 GO:0032270 GO:0034248 GO:0034250 GO:0043226 GO:0043227 GO:0043229 GO:0043231 GO:0043233 GO:0044237 GO:0044422 GO:0044424 GO:0044429 GO:0044444 GO:0044446 GO:0044464 GO:0045182 GO:0045333 GO:0045727 GO:0048518 GO:0048522 GO:0050789 GO:0050794 GO:0051171 GO:0051173 GO:0051246 GO:0051247 GO:0055114 GO:0060255 GO:0065007 GO:0070013 GO:0070129 GO:0070131 GO:0080090 GO:0090079 GO:0097159 GO:1901363 GO:2000112

KEGG Pathways

Metabolic & Signaling

ko05168 map05168

Pfam Domains

Protein Families

MAM33

Protein Analysis

54

Amino Acids

6.08

Weight (kDa)

9.99

Isoelectric Point (pI)

50.76

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0007357)

Species	Orthologous Gene IDs
arabidopsis_thaliana	AT2G41600 AT2G41600 AT2G41600 AT2G41600 AT2G41600 AT2G41600 AT2G41600
fragaria_vesca	FvH4_6g24410
malus_domestica	MD14G1076800.v1.1 MD14G1125800.v1.1
prunus_persica	Prupe.7G054700_v2.0.a1 Prupe.7G054700_v2.0.a1
pyrus_communis	pycom14g06510
rosa_chinensis	RchiOBHm_Chr3g0483391
rosa_laevigata	RLG00000023287
rosa_multiflora	Rmu_sc0006349.1_g000008 Rmu_sc0009753.1_g000002
rosa_roxburghii	Rroxscaffold_6G00398390
rosa_rugosa	Rorug03G0205700
rosa_samantha	Rh3AG254100 Rh3BG291200 Rh3CG288400 Rh3DG284200
rosa_wichuraiana	Rw0G023720 Rw0G023750

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	1 cut(s)	11
AfeI	AGCGCT	1 cut(s)	110
AgsI	TTSAA	1 cut(s)	43
AluBI	AGCT	2 cut(s)	29, 82
AluI	AGCT	2 cut(s)	29, 82
Aor51HI	AGCGCT	1 cut(s)	110
AspLEI	GCGC	1 cut(s)	111
BfaI	CTAG	1 cut(s)	152
BfoI	RGCGCY	1 cut(s)	112
BplI	GAGNNNNNCTC	2 cut(s)	71, 103
Bpu10I	CCTNAGC	1 cut(s)	50
BseMII	CTCAG	2 cut(s)	64, 120
BspACI	CCGC	1 cut(s)	11
BspCNI	CTCAG	2 cut(s)	63, 121
BstDEI	CTNAG	2 cut(s)	50, 129
BstH2I	RGCGCY	1 cut(s)	112
BstHHI	GCGC	1 cut(s)	111
CfoI	GCGC	1 cut(s)	111
CviJI	RGCY	3 cut(s)	29, 56, 82
CviKI_1	RGCY	3 cut(s)	29, 56, 82
DdeI	CTNAG	2 cut(s)	50, 129
Eco47III	AGCGCT	1 cut(s)	110
FauI	CCCGC	1 cut(s)	4
FspBI	CTAG	1 cut(s)	152
GlaI	GCGC	1 cut(s)	110
HaeII	RGCGCY	1 cut(s)	112
HhaI	GCGC	1 cut(s)	111
Hin6I	GCGC	1 cut(s)	109
HinP1I	GCGC	1 cut(s)	109
Hpy188I	TCNGA	2 cut(s)	67, 130
HpyCH4V	TGCA	1 cut(s)	61
HpyF3I	CTNAG	2 cut(s)	50, 129
HspAI	GCGC	1 cut(s)	109
LpnPI	CCDG	2 cut(s)	2, 37
MaeI	CTAG	1 cut(s)	152
MluCI	AATT	2 cut(s)	38, 124
MmeI	TCCRAC	1 cut(s)	139
MnlI	CCTC	2 cut(s)	97, 159
SetI	ASST	3 cut(s)	31, 84, 157
SgeI	CNNG	7 cut(s)	20, 24, 29, 58, 64, 79, 91
Sse9I	AATT	2 cut(s)	38, 124
SsiI	CCGC	1 cut(s)	11
SspMI	CTAG	1 cut(s)	152
TasI	AATT	2 cut(s)	38, 124
XspI	CTAG	1 cut(s)	152

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.