MD15G1316700.v1.1

Pentatricopeptide repeat-containing protein

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr15
Physical Location & Seq
Forward (+)
32623338 .. 32624712
1375 bp
Loading structure...
UTR
Exon/CDS
Intron
MD15G1316700.v1.1.491

Sequence Viewer

Length: 198 bp
ATGCCTCAACGAAATCAAGTTTGTAGAATTGGGTCTTTGGAGGTAGAAGGTGAGGCTTTGTGTAGTAGTCAATCAAATAAACTGGTTAATGACTTGCAGATGCAGGATAATGGTATTGATAGGACTGTTGGTTTGACTGCACCTGGAGATGTAGACCCTCCACTTCGCGCATACCGGCAATTCAACTCAGTGTCATAA

Protein Analysis

66

Amino Acids

7.12

Weight (kDa)

4.72

Isoelectric Point (pI)

39.52

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccI GTMKAC 1 cut(s) 153
AccII CGCG 1 cut(s) 168
AgsI TTSAA 1 cut(s) 184
AjnI CCWGG 1 cut(s) 142
ArsI GACNNNNNNTTYG 2 cut(s) 115, 147
AspLEI GCGC 1 cut(s) 170
AsuHPI GGTGA 1 cut(s) 62
BciT130I CCWGG 1 cut(s) 144
Bme1390I CCNGG 1 cut(s) 144
BmrFI CCNGG 1 cut(s) 144
BmsI GCATC 1 cut(s) 90
BpmI CTGGAG 1 cut(s) 165
Bse118I RCCGGY 1 cut(s) 174
Bse1I ACTGG 1 cut(s) 87
BseBI CCWGG 1 cut(s) 144
BseNI ACTGG 1 cut(s) 87
BsgI GTGCAG 1 cut(s) 123
Bsh1236I CGCG 1 cut(s) 168
BsiSI CCGG 1 cut(s) 175
BspFNI CGCG 1 cut(s) 168
BsrFI RCCGGY 1 cut(s) 174
BsrI ACTGG 1 cut(s) 87
BssAI RCCGGY 1 cut(s) 174
Bst2UI CCWGG 1 cut(s) 144
Bst4CI ACNGT 1 cut(s) 127
BstDEI CTNAG 1 cut(s) 187
BstFNI CGCG 1 cut(s) 168
BstHHI GCGC 1 cut(s) 170
BstNI CCWGG 1 cut(s) 144
BstSCI CCNGG 1 cut(s) 142
BstUI CGCG 1 cut(s) 168
BtsIMutI CAGTG 1 cut(s) 195
CfoI GCGC 1 cut(s) 170
Cfr10I RCCGGY 1 cut(s) 174
CviJI RGCY 1 cut(s) 56
CviKI_1 RGCY 1 cut(s) 56
DdeI CTNAG 1 cut(s) 187
EcoRII CCWGG 1 cut(s) 142
FaiI YATR 2 cut(s) 172, 196
FblI GTMKAC 1 cut(s) 153
GlaI GCGC 1 cut(s) 169
GsuI CTGGAG 1 cut(s) 165
HapII CCGG 1 cut(s) 175
HhaI GCGC 1 cut(s) 170
Hin6I GCGC 1 cut(s) 168
HinP1I GCGC 1 cut(s) 168
HpaII CCGG 1 cut(s) 175
HphI GGTGA 1 cut(s) 62
Hpy166II GTNNAC 1 cut(s) 154
Hpy8I GTNNAC 1 cut(s) 154
HpyAV CCTTC 1 cut(s) 41
HpyCH4III ACNGT 1 cut(s) 127
HpyCH4V TGCA 3 cut(s) 97, 103, 140
HpyF3I CTNAG 1 cut(s) 187
HspAI GCGC 1 cut(s) 168
LpnPI CCDG 5 cut(s) 68, 89, 129, 156, 188
LweI GCATC 1 cut(s) 90
MluCI AATT 2 cut(s) 27, 179
MnlI CCTC 4 cut(s) 15, 34, 46, 168
MseI TTAA 1 cut(s) 87
MspI CCGG 1 cut(s) 175
MspR9I CCNGG 1 cut(s) 144
MvaI CCWGG 1 cut(s) 144
MvnI CGCG 1 cut(s) 168
Psp6I CCWGG 1 cut(s) 142
PspGI CCWGG 1 cut(s) 142
SaqAI TTAA 1 cut(s) 87
ScrFI CCNGG 1 cut(s) 144
SetI ASST 3 cut(s) 45, 52, 145
SfaNI GCATC 1 cut(s) 90
SgeI CNNG 8 cut(s) 29, 95, 106, 116, 155, 156, 179, 187
Sse9I AATT 2 cut(s) 27, 179
StyD4I CCNGG 1 cut(s) 142
TaaI ACNGT 1 cut(s) 127
TasI AATT 2 cut(s) 27, 179
Tru1I TTAA 1 cut(s) 87
Tru9I TTAA 1 cut(s) 87
TscAI CASTG 1 cut(s) 195
TspRI CASTG 1 cut(s) 195
XmiI GTMKAC 1 cut(s) 153
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.