MD16G1101900.v1.1

Belongs to the iron ascorbate-dependent oxidoreductase family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr16
OG0014722
Physical Location & Seq
Reverse (-)
7113612 .. 7114362
751 bp
Loading structure...
UTR
Exon/CDS
Intron
MD16G1101900.v1.1.491

Sequence Viewer

Length: 486 bp
ATGATGACTGCCATGGCCCAGTTCTTCAAATTGCCTCCTGAAGAAAGGGCAAAATACTTCACCACTGATCACTCCAAGCAAGTAAAGCTTTTCAATTTCTACCTCAAAGTTGAAGGGCAAGAGCAAAAGGTCACTATGTGGAGTGAAACCTTCTCACATCTTTGGCATCCTCTTAATTCCTTGCCTGAAAATCCTCCCCAATACGGATTGATGAAAACGCTCTTGGGATTGCTATCCCAGGGGCTTGGACTAGAGAAGGACTGCTTACAAAAGAAGCTGGATGATAATCCTACTCTGAAAGCACAGGGAAACTACCATCCACCATGTCCAGACCCTGAGGTCACACTTGGACTAGCTATCCATACTGATCTCAATGCACTCACAGTACTCAAGCAGACAGAGGGAGTGACTGGCCTTCAAGTGATCAAAGATGGGAAATGGGTTGCTGTCGATTCTCTCCCCCAATGCCTTTGTTATCAATCTTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
2OG-FeII_Oxy DIOX_N

Protein Analysis

162

Amino Acids

18.18

Weight (kDa)

6.19

Isoelectric Point (pI)

36.52

Instability Index
Protein Domains (Pfam)
Domain Name Pfam ID Position E-value Description
2OG-FeII_Oxy PF03171 104 - 159 2.2e-12 2OG-Fe(II) oxygenase superfamily
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0014722)

Species Orthologous Gene IDs
fragaria_vesca FvH4_4g25590
malus_domestica MD16G1101600.v1.1 MD16G1101900.v1.1
prunus_persica Prupe.8G011800_v2.0.a1
pyrus_communis pycom16g08630
rosa_chinensis RchiOBHm_Chr5g0016311
rosa_laevigata RLG00000006792
rosa_multiflora Rmu_co8454895.1_g000001 Rmu_sc0001762.1_g000036
rosa_roxburghii Rroxscaffold_5G00374460
rosa_samantha Rh1AG277500 Rh4AG318700 Rh4BG326800 Rh4CG342200 Rh4DG322000 Rh5CG136300
rosa_wichuraiana Rw4G022550

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AasI GACNNNNNNGTC 1 cut(s) 338
AcuI CTGAAG 1 cut(s) 60
AdeI CACNNNGTG 1 cut(s) 138
AfaI GTAC 1 cut(s) 387
AfiI CCNNNNNNNGG 1 cut(s) 203
AgsI TTSAA 4 cut(s) 28, 94, 113, 419
AjnI CCWGG 1 cut(s) 237
AjuI GAANNNNNNNTTGG 2 cut(s) 206, 238
AluBI AGCT 3 cut(s) 88, 277, 356
AluI AGCT 3 cut(s) 88, 277, 356
AlwNI CAGNNNCTG 1 cut(s) 335
AoxI GGCC 2 cut(s) 15, 412
AspS9I GGNCC 1 cut(s) 16
AsuHPI GGTGA 1 cut(s) 52
AxyI CCTNAGG 1 cut(s) 336
BccI CCATC 2 cut(s) 324, 425
BciT130I CCWGG 1 cut(s) 239
BclI TGATCA 2 cut(s) 67, 423
BfaI CTAG 2 cut(s) 251, 353
BmcAI AGTACT 1 cut(s) 387
Bme1390I CCNGG 1 cut(s) 239
BmgT120I GGNCC 1 cut(s) 16
BmrFI CCNGG 1 cut(s) 239
BmrI ACTGGG 1 cut(s) 13
BmsI GCATC 1 cut(s) 175
BmuI ACTGGG 1 cut(s) 13
BpuEI CTTGAG 1 cut(s) 374
BsaBI GATNNNNATC 2 cut(s) 232, 285
BsaJI CCNNGG 3 cut(s) 12, 237, 238
Bsc4I CCNNNNNNNGG 1 cut(s) 203
Bse1I ACTGG 2 cut(s) 19, 415
Bse21I CCTNAGG 1 cut(s) 336
Bse8I GATNNNNATC 2 cut(s) 232, 285
BseBI CCWGG 1 cut(s) 239
BseDI CCNNGG 3 cut(s) 12, 237, 238
BseGI GGATG 3 cut(s) 166, 286, 316
BseJI GATNNNNATC 2 cut(s) 232, 285
BseLI CCNNNNNNNGG 1 cut(s) 203
BseMII CTCAG 1 cut(s) 327
BseNI ACTGG 2 cut(s) 19, 415
BshFI GGCC 2 cut(s) 17, 414
BslI CCNNNNNNNGG 1 cut(s) 203
BsnI GGCC 2 cut(s) 17, 414
Bsp143I GATC 3 cut(s) 67, 367, 423
Bsp19I CCATGG 1 cut(s) 12
BspANI GGCC 2 cut(s) 17, 414
BspCNI CTCAG 1 cut(s) 328
BsrI ACTGG 2 cut(s) 19, 415
BssECI CCNNGG 3 cut(s) 12, 237, 238
BssMI GATC 3 cut(s) 67, 367, 423
BssT1I CCWWGG 1 cut(s) 12
Bst2UI CCWGG 1 cut(s) 239
Bst4CI ACNGT 1 cut(s) 385
BstDEI CTNAG 1 cut(s) 336
BstDSI CCRYGG 1 cut(s) 12
BstF5I GGATG 3 cut(s) 166, 286, 316
BstKTI GATC 3 cut(s) 70, 370, 426
BstMBI GATC 3 cut(s) 67, 367, 423
BstMWI GCNNNNNNNGC 1 cut(s) 85
BstNI CCWGG 1 cut(s) 239
BstSCI CCNGG 1 cut(s) 237
BstXI CCANNNNNNTGG 1 cut(s) 245
Bsu36I CCTNAGG 1 cut(s) 336
BsuRI GGCC 2 cut(s) 17, 414
BtgI CCRYGG 1 cut(s) 12
BtsCI GGATG 3 cut(s) 166, 286, 316
BtsIMutI CAGTG 1 cut(s) 63
CaiI CAGNNNCTG 1 cut(s) 335
Cfr13I GGNCC 1 cut(s) 16
Csp6I GTAC 1 cut(s) 386
CviAII CATG 2 cut(s) 13, 324
CviJI RGCY 6 cut(s) 17, 88, 244, 277, 356, 414
CviKI_1 RGCY 6 cut(s) 17, 88, 244, 277, 356, 414
CviQI GTAC 1 cut(s) 386
DdeI CTNAG 1 cut(s) 336
DpnI GATC 3 cut(s) 69, 369, 425
DpnII GATC 3 cut(s) 67, 367, 423
DraIII CACNNNGTG 1 cut(s) 138
DrdI GACNNNNNNGTC 1 cut(s) 338
DseDI GACNNNNNNGTC 1 cut(s) 338
Eco130I CCWWGG 1 cut(s) 12
Eco57I CTGAAG 1 cut(s) 60
Eco81I CCTNAGG 1 cut(s) 336
EcoRII CCWGG 1 cut(s) 237
EcoT14I CCWWGG 1 cut(s) 12
ErhI CCWWGG 1 cut(s) 12
FaeI CATG 2 cut(s) 16, 327
FaiI YATR 4 cut(s) 14, 137, 325, 363
FalI AAGNNNNNCTT 4 cut(s) 72, 104, 248, 280
FatI CATG 2 cut(s) 12, 323
FbaI TGATCA 2 cut(s) 67, 423
FokI GGATG 3 cut(s) 153, 293, 303
FspBI CTAG 2 cut(s) 251, 353
HaeIII GGCC 2 cut(s) 17, 414
Hin1II CATG 2 cut(s) 16, 327
HindIII AAGCTT 1 cut(s) 86
HinfI GANTC 1 cut(s) 452
HphI GGTGA 1 cut(s) 52
Hpy188I TCNGA 1 cut(s) 297
Hpy188III TCNNGA 2 cut(s) 38, 329
HpyAV CCTTC 4 cut(s) 107, 160, 250, 425
HpyCH4III ACNGT 1 cut(s) 385
HpyCH4V TGCA 1 cut(s) 377
HpyF10VI GCNNNNNNNGC 1 cut(s) 85
HpyF3I CTNAG 1 cut(s) 336
Hsp92II CATG 2 cut(s) 16, 327
Ksp22I TGATCA 2 cut(s) 67, 423
Kzo9I GATC 3 cut(s) 67, 367, 423
LweI GCATC 1 cut(s) 175
MaeI CTAG 2 cut(s) 251, 353
MaeIII GTNAC 3 cut(s) 130, 340, 406
MalI GATC 3 cut(s) 69, 369, 425
MboI GATC 3 cut(s) 67, 367, 423
MboII GAAGA 2 cut(s) 16, 53
MluCI AATT 3 cut(s) 29, 94, 175
MnlI CCTC 6 cut(s) 45, 113, 180, 204, 331, 394
MseI TTAA 2 cut(s) 174, 484
MspR9I CCNGG 1 cut(s) 239
MvaI CCWGG 1 cut(s) 239
MwoI GCNNNNNNNGC 1 cut(s) 85
NcoI CCATGG 1 cut(s) 12
NdeII GATC 3 cut(s) 67, 367, 423
NlaIII CATG 2 cut(s) 16, 327
NmuCI GTSAC 3 cut(s) 130, 340, 406
PasI CCCWGGG 1 cut(s) 238
PfeI GAWTC 1 cut(s) 452
Psp6I CCWGG 1 cut(s) 237
PspGI CCWGG 1 cut(s) 237
PspPI GGNCC 1 cut(s) 16
PstNI CAGNNNCTG 1 cut(s) 335
RsaI GTAC 1 cut(s) 387
RsaNI GTAC 1 cut(s) 386
SaqAI TTAA 2 cut(s) 174, 484
Sau3AI GATC 3 cut(s) 67, 367, 423
Sau96I GGNCC 1 cut(s) 16
ScaI AGTACT 1 cut(s) 387
ScrFI CCNGG 1 cut(s) 239
SetI ASST 7 cut(s) 90, 105, 132, 152, 279, 342, 358
SfaNI GCATC 1 cut(s) 175
SmlI CTYRAG 1 cut(s) 389
SmoI CTYRAG 1 cut(s) 389
Sse9I AATT 3 cut(s) 29, 94, 175
SspMI CTAG 2 cut(s) 251, 353
StyD4I CCNGG 1 cut(s) 237
StyI CCWWGG 1 cut(s) 12
TaaI ACNGT 1 cut(s) 385
TaqI TCGA 1 cut(s) 450
TasI AATT 3 cut(s) 29, 94, 175
TatI WGTACW 1 cut(s) 385
TfiI GAWTC 1 cut(s) 452
Tru1I TTAA 2 cut(s) 174, 484
Tru9I TTAA 2 cut(s) 174, 484
TscAI CASTG 1 cut(s) 70
TseFI GTSAC 3 cut(s) 130, 340, 406
Tsp45I GTSAC 3 cut(s) 130, 340, 406
TspDTI ATGAA 1 cut(s) 227
TspGWI ACGGA 1 cut(s) 219
TspRI CASTG 1 cut(s) 70
XspI CTAG 2 cut(s) 251, 353
ZrmI AGTACT 1 cut(s) 387
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.