MD16G1223700.v1.1

Exopolygalacturonase-like

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr16
OG0013649
Physical Location & Seq
Reverse (-)
22489762 .. 22490055
294 bp
Loading structure...
UTR
Exon/CDS
Intron
MD16G1223700.v1.1.491

Sequence Viewer

Length: 294 bp
ATGTGTGTATTGGGAATGTTTGTGTTGTTATTGTTAACATCTACAAGTAAAGCTCATGAGTCCGAACACGATTCTAGTGTTTTTGATGTGACAAGAGCAGAATATGGTGCAAAGCCTGGCTCTGATATTACTTTTGCATTGGCCAAGGCTTGGAATGACTCGTGTGCATCACCGTCCGCTAGTAAAGTTGTTGTTCCGAGCGGGACATACAAGTTAAGAGGAGCAAGTTTTCGAGGTCCTTGCAAGGCTCCGATTGAGCTTCAAGTGCACGGAACATTGCAGGCTCCAGAATAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
GO:0005575 GO:0005576 GO:0005618 GO:0005623 GO:0030312 GO:0044464 GO:0071944
KEGG Pathways
Metabolic & Signaling
ko00040 ko01100 map00040 map01100
Pfam Domains
Protein Families
Glyco_hydro_28

Protein Analysis

98

Amino Acids

10.27

Weight (kDa)

6.81

Isoelectric Point (pI)

41.91

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB7I CCANNNNNTGG 1 cut(s) 150
AccBSI CCGCTC 1 cut(s) 201
AciI CCGC 2 cut(s) 177, 201
AcoI YGGCCR 1 cut(s) 141
AfiI CCNNNNNNNGG 1 cut(s) 150
AgsI TTSAA 1 cut(s) 263
AjnI CCWGG 1 cut(s) 115
AluBI AGCT 2 cut(s) 53, 259
AluI AGCT 2 cut(s) 53, 259
Alw21I GWGCWC 1 cut(s) 270
Alw44I GTGCAC 1 cut(s) 266
AoxI GGCC 1 cut(s) 141
ApaLI GTGCAC 1 cut(s) 266
AspS9I GGNCC 1 cut(s) 236
AsuHPI GGTGA 1 cut(s) 162
AvaII GGWCC 1 cut(s) 236
BaeGI GKGCMC 1 cut(s) 270
BalI TGGCCA 1 cut(s) 143
BauI CACGAG 1 cut(s) 160
Bbv12I GWGCWC 1 cut(s) 270
BcgI CGANNNNNNTGC 2 cut(s) 222, 256
BciT130I CCWGG 1 cut(s) 117
BfaI CTAG 2 cut(s) 75, 180
Bme1390I CCNGG 1 cut(s) 117
Bme18I GGWCC 1 cut(s) 236
BmgT120I GGNCC 1 cut(s) 236
BmiI GGNNCC 2 cut(s) 249, 285
BmrFI CCNGG 1 cut(s) 117
BmsI GCATC 1 cut(s) 176
BpmI CTGGAG 1 cut(s) 270
BsaJI CCNNGG 1 cut(s) 144
Bsc4I CCNNNNNNNGG 1 cut(s) 150
Bse3DI GCAATG 1 cut(s) 275
BseBI CCWGG 1 cut(s) 117
BseDI CCNNGG 1 cut(s) 144
BseLI CCNNNNNNNGG 1 cut(s) 150
BseMI GCAATG 1 cut(s) 275
BseRI GAGGAG 1 cut(s) 234
BseSI GKGCMC 1 cut(s) 270
BshFI GGCC 1 cut(s) 143
BsiHKAI GWGCWC 1 cut(s) 270
BslFI GGGAC 1 cut(s) 217
BslI CCNNNNNNNGG 1 cut(s) 150
BsmFI GGGAC 1 cut(s) 217
BsnI GGCC 1 cut(s) 143
Bsp1286I GDGCHC 1 cut(s) 270
BspACI CCGC 2 cut(s) 177, 201
BspANI GGCC 1 cut(s) 143
BspHI TCATGA 1 cut(s) 55
BspLI GGNNCC 2 cut(s) 249, 285
BsrBI CCGCTC 1 cut(s) 201
BsrDI GCAATG 1 cut(s) 275
BssECI CCNNGG 1 cut(s) 144
BssSI CACGAG 1 cut(s) 160
BssT1I CCWWGG 1 cut(s) 144
Bst2BI CACGAG 1 cut(s) 160
Bst2UI CCWGG 1 cut(s) 117
Bst4CI ACNGT 1 cut(s) 174
BstC8I GCNNGC 1 cut(s) 282
BstMWI GCNNNNNNNGC 1 cut(s) 265
BstNI CCWGG 1 cut(s) 117
BstSCI CCNGG 1 cut(s) 115
BstSLI GKGCMC 1 cut(s) 270
BsuRI GGCC 1 cut(s) 143
Cac8I GCNNGC 1 cut(s) 282
CciI TCATGA 1 cut(s) 55
Cfr13I GGNCC 1 cut(s) 236
CviAII CATG 1 cut(s) 56
CviJI RGCY 8 cut(s) 53, 115, 120, 143, 149, 248, 259, 284
CviKI_1 RGCY 8 cut(s) 53, 115, 120, 143, 149, 248, 259, 284
EaeI YGGCCR 1 cut(s) 141
Eco130I CCWWGG 1 cut(s) 144
Eco47I GGWCC 1 cut(s) 236
EcoO109I RGGNCCY 1 cut(s) 236
EcoRII CCWGG 1 cut(s) 115
EcoT14I CCWWGG 1 cut(s) 144
ErhI CCWWGG 1 cut(s) 144
FaeI CATG 1 cut(s) 59
FaiI YATR 3 cut(s) 57, 105, 208
FaqI GGGAC 1 cut(s) 217
FatI CATG 1 cut(s) 55
FauI CCCGC 1 cut(s) 194
FspBI CTAG 2 cut(s) 75, 180
GsuI CTGGAG 1 cut(s) 270
HaeIII GGCC 1 cut(s) 143
Hin1II CATG 1 cut(s) 59
HincII GTYRAC 1 cut(s) 36
HindII GTYRAC 1 cut(s) 36
HinfI GANTC 3 cut(s) 59, 71, 158
HpaI GTTAAC 1 cut(s) 36
HphI GGTGA 1 cut(s) 162
Hpy166II GTNNAC 2 cut(s) 36, 268
Hpy188I TCNGA 4 cut(s) 64, 124, 198, 252
Hpy188III TCNNGA 2 cut(s) 56, 287
Hpy8I GTNNAC 2 cut(s) 36, 268
HpyCH4III ACNGT 1 cut(s) 174
HpyCH4V TGCA 6 cut(s) 110, 137, 167, 243, 268, 280
HpyF10VI GCNNNNNNNGC 1 cut(s) 265
Hsp92II CATG 1 cut(s) 59
KspAI GTTAAC 1 cut(s) 36
LmnI GCTCC 3 cut(s) 221, 253, 289
LpnPI CCDG 3 cut(s) 102, 129, 266
LweI GCATC 1 cut(s) 176
MaeI CTAG 2 cut(s) 75, 180
MaeIII GTNAC 1 cut(s) 88
MbiI CCGCTC 1 cut(s) 201
MhlI GDGCHC 1 cut(s) 270
MlsI TGGCCA 1 cut(s) 143
MluNI TGGCCA 1 cut(s) 143
MlyI GAGTC 2 cut(s) 68, 152
MnlI CCTC 2 cut(s) 212, 227
Mox20I TGGCCA 1 cut(s) 143
MscI TGGCCA 1 cut(s) 143
MseI TTAA 2 cut(s) 35, 215
Msp20I TGGCCA 1 cut(s) 143
MspR9I CCNGG 1 cut(s) 117
MvaI CCWGG 1 cut(s) 117
MwoI GCNNNNNNNGC 1 cut(s) 265
NlaIII CATG 1 cut(s) 59
NlaIV GGNNCC 2 cut(s) 249, 285
NmuCI GTSAC 1 cut(s) 88
PagI TCATGA 1 cut(s) 55
PfeI GAWTC 1 cut(s) 71
PflMI CCANNNNNTGG 1 cut(s) 150
PleI GAGTC 2 cut(s) 67, 152
PpsI GAGTC 2 cut(s) 67, 152
PpuMI RGGWCCY 1 cut(s) 236
Psp5II RGGWCCY 1 cut(s) 236
Psp6I CCWGG 1 cut(s) 115
PspGI CCWGG 1 cut(s) 115
PspN4I GGNNCC 2 cut(s) 249, 285
PspPI GGNCC 1 cut(s) 236
PspPPI RGGWCCY 1 cut(s) 236
SaqAI TTAA 2 cut(s) 35, 215
Sau96I GGNCC 1 cut(s) 236
SchI GAGTC 2 cut(s) 68, 152
ScrFI CCNGG 1 cut(s) 117
SduI GDGCHC 1 cut(s) 270
SetI ASST 3 cut(s) 55, 238, 261
SfaNI GCATC 1 cut(s) 176
SinI GGWCC 1 cut(s) 236
SsiI CCGC 2 cut(s) 177, 201
SspMI CTAG 2 cut(s) 75, 180
StyD4I CCNGG 1 cut(s) 115
StyI CCWWGG 1 cut(s) 144
TaaI ACNGT 1 cut(s) 174
TaqI TCGA 1 cut(s) 232
TfiI GAWTC 1 cut(s) 71
Tru1I TTAA 2 cut(s) 35, 215
Tru9I TTAA 2 cut(s) 35, 215
TseFI GTSAC 1 cut(s) 88
Tsp45I GTSAC 1 cut(s) 88
TspGWI ACGGA 1 cut(s) 285
Van91I CCANNNNNTGG 1 cut(s) 150
VneI GTGCAC 1 cut(s) 266
VpaK11BI GGWCC 1 cut(s) 236
XspI CTAG 2 cut(s) 75, 180
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.