Rmu_sc0001066.1_g000014

Exopolygalacturonase-like

Basic Information

Type: gene
Biological Identity
rosa_multiflora
Rmu_sc0001066.1
Physical Location & Seq
Forward (+)
72743 .. 73437
695 bp
Loading structure...
UTR
Exon/CDS
Intron
Rmu_sc0001066.1_g000014.1.cds

Sequence Viewer

Length: 462 bp
atgttggcgtttacaactaaaattcaatcctctgtcgtctttgacgtgacaagtgcaaaatatgggggaaagccaagctcagacattacaaaggctttgctgaatgcttggactgatgcatgtgcatcaccgagggagagtaaagttcttgttccaagaggcacctacagattaaaaggagcaattttcagaggtcattgcaaggctcctattgaacttcaggtccgaggcacattgcaggctctaaaacacaccagccaagtcacatcaccggatacttggaacataaggttcgacttcgtcaacgatacaataattaaggacataacttcacttgacagcaagaactttcacttcaacgttttcgccagcaagaactttcacttcaacgttttcgcctgccacaatgttactttccaacatgcaaccatcacagcacccggagagagtgttaagtgttaa
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
KEGG Pathways
Metabolic & Signaling
Pfam Domains
Protein Families

Protein Analysis

153

Amino Acids

16.97

Weight (kDa)

9.44

Isoelectric Point (pI)

32.19

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 161
AclI AACGTT 2 cut(s) 360, 390
AcsI RAATTY 1 cut(s) 21
AcuI CTGAAG 1 cut(s) 203
AgsI TTSAA 4 cut(s) 26, 215, 358, 388
AjiI CACGTC 1 cut(s) 46
AloI GAACNNNNNNTCC 2 cut(s) 207, 239
AluBI AGCT 1 cut(s) 78
AluI AGCT 1 cut(s) 78
ApoI RAATTY 1 cut(s) 21
AspS9I GGNCC 1 cut(s) 223
AsuC2I CCSGG 1 cut(s) 441
AsuHPI GGTGA 2 cut(s) 120, 261
AvaII GGWCC 1 cut(s) 223
BanI GGYRCC 1 cut(s) 161
BccI CCATC 1 cut(s) 437
BciVI GTATCC 1 cut(s) 268
BcnI CCSGG 1 cut(s) 441
BfmI CTRYAG 1 cut(s) 166
BfuI GTATCC 1 cut(s) 268
Bme1390I CCNGG 1 cut(s) 441
Bme18I GGWCC 1 cut(s) 223
BmgBI CACGTC 1 cut(s) 46
BmgT120I GGNCC 1 cut(s) 223
BmiI GGNNCC 2 cut(s) 163, 207
BmrFI CCNGG 1 cut(s) 441
BmsI GCATC 2 cut(s) 106, 134
BpuMI CCSGG 1 cut(s) 441
BsaJI CCNNGG 2 cut(s) 131, 226
BsaWI WCCGGW 1 cut(s) 271
BsaXI ACNNNNNCTCC 1 cut(s) 435
Bse3DI GCAATG 2 cut(s) 196, 233
BseDI CCNNGG 2 cut(s) 131, 226
BseMI GCAATG 2 cut(s) 196, 233
BseMII CTCAG 1 cut(s) 93
BshNI GGYRCC 1 cut(s) 161
BsiSI CCGG 2 cut(s) 272, 441
BsmI GAATGC 1 cut(s) 109
BspCNI CTCAG 1 cut(s) 92
BspLI GGNNCC 2 cut(s) 163, 207
BspT107I GGYRCC 1 cut(s) 161
BsrDI GCAATG 2 cut(s) 196, 233
BssECI CCNNGG 2 cut(s) 131, 226
BstC8I GCNNGC 3 cut(s) 240, 370, 400
BstDEI CTNAG 1 cut(s) 79
BstNSI RCATGY 2 cut(s) 123, 425
BstSCI CCNGG 1 cut(s) 439
BstSFI CTRYAG 1 cut(s) 166
BsuI GTATCC 1 cut(s) 268
BtrI CACGTC 1 cut(s) 46
Cac8I GCNNGC 3 cut(s) 240, 370, 400
Cfr13I GGNCC 1 cut(s) 223
CviAII CATG 2 cut(s) 120, 422
CviJI RGCY 6 cut(s) 73, 78, 95, 206, 242, 258
CviKI_1 RGCY 6 cut(s) 73, 78, 95, 206, 242, 258
DdeI CTNAG 1 cut(s) 79
Eco47I GGWCC 1 cut(s) 223
Eco57I CTGAAG 1 cut(s) 203
EcoT22I ATGCAT 1 cut(s) 121
FaeI CATG 2 cut(s) 123, 425
FaiI YATR 5 cut(s) 63, 121, 287, 326, 423
FatI CATG 2 cut(s) 119, 421
HapII CCGG 2 cut(s) 272, 441
Hin1II CATG 2 cut(s) 123, 425
HincII GTYRAC 1 cut(s) 304
HindII GTYRAC 1 cut(s) 304
HpaII CCGG 2 cut(s) 272, 441
HphI GGTGA 2 cut(s) 120, 261
Hpy166II GTNNAC 2 cut(s) 12, 304
Hpy188I TCNGA 3 cut(s) 82, 191, 227
Hpy8I GTNNAC 2 cut(s) 12, 304
HpyCH4IV ACGT 3 cut(s) 45, 360, 390
HpyCH4V TGCA 6 cut(s) 56, 119, 125, 201, 238, 425
HpyF3I CTNAG 1 cut(s) 79
HpySE526I ACGT 3 cut(s) 45, 360, 390
Hsp92II CATG 2 cut(s) 123, 425
LmnI GCTCC 2 cut(s) 179, 211
LpnPI CCDG 7 cut(s) 206, 224, 268, 285, 382, 412, 454
LweI GCATC 2 cut(s) 106, 134
MaeII ACGT 3 cut(s) 45, 360, 390
MaeIII GTNAC 3 cut(s) 46, 262, 409
MluCI AATT 3 cut(s) 21, 183, 315
MmeI TCCRAC 1 cut(s) 442
MnlI CCTC 5 cut(s) 40, 126, 152, 185, 221
Mph1103I ATGCAT 1 cut(s) 121
MseI TTAA 4 cut(s) 173, 318, 453, 460
MspI CCGG 2 cut(s) 272, 441
MspR9I CCNGG 1 cut(s) 441
Mva1269I GAATGC 1 cut(s) 109
NciI CCSGG 1 cut(s) 441
NlaIII CATG 2 cut(s) 123, 425
NlaIV GGNNCC 2 cut(s) 163, 207
NmuCI GTSAC 2 cut(s) 46, 262
NsiI ATGCAT 1 cut(s) 121
NspI RCATGY 2 cut(s) 123, 425
PcsI WCGNNNNNNNCGW 1 cut(s) 42
PctI GAATGC 1 cut(s) 109
PflFI GACNNNGTC 1 cut(s) 299
Psp1406I AACGTT 2 cut(s) 360, 390
PspN4I GGNNCC 2 cut(s) 163, 207
PspPI GGNCC 1 cut(s) 223
PsyI GACNNNGTC 1 cut(s) 299
SaqAI TTAA 4 cut(s) 173, 318, 453, 460
Sau96I GGNCC 1 cut(s) 223
ScrFI CCNGG 1 cut(s) 441
SetI ASST 8 cut(s) 48, 80, 167, 196, 225, 293, 363, 393
SfaNI GCATC 2 cut(s) 106, 134
SfcI CTRYAG 1 cut(s) 166
SinI GGWCC 1 cut(s) 223
Sse9I AATT 3 cut(s) 21, 183, 315
StyD4I CCNGG 1 cut(s) 439
TaiI ACGT 3 cut(s) 48, 363, 393
TaqI TCGA 1 cut(s) 294
TasI AATT 3 cut(s) 21, 183, 315
Tru1I TTAA 4 cut(s) 173, 318, 453, 460
Tru9I TTAA 4 cut(s) 173, 318, 453, 460
TseFI GTSAC 2 cut(s) 46, 262
Tsp45I GTSAC 2 cut(s) 46, 262
Tth111I GACNNNGTC 1 cut(s) 299
VpaK11BI GGWCC 1 cut(s) 223
XapI RAATTY 1 cut(s) 21
XceI RCATGY 2 cut(s) 123, 425
Zsp2I ATGCAT 1 cut(s) 121
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.