MD17G1043300.v1.1

No description available

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr17
OG0007717
Physical Location & Seq
Forward (+)
3175403 .. 3175882
480 bp
Loading structure...
UTR
Exon/CDS
Intron
MD17G1043300.v1.1.491

Sequence Viewer

Length: 174 bp
ATGAACGAAGCAGCAATTCAAACGCTGGAGTTGAGGATTTCTCATACACAAGAAGAGATTTCCGACGTTGGATCTGAAGTCGAAGCTCTCAAGAACAAACAAGCTGCTTCGCGAGACGAGTTTATAAGTGAAATGATTGAGATAAACACTAAGATAAGGTTAGCATCATTTTAG
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
ko04260 ko04261 ko05410 ko05414 map04260 map04261 map05410 map05414
Pfam Domains
Protein Families
No domains found.

Protein Analysis

58

Amino Acids

6.44

Weight (kDa)

4.63

Isoelectric Point (pI)

46.6

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AanI TTATAA 1 cut(s) 125
AccII CGCG 1 cut(s) 112
AclWI GGATC 1 cut(s) 79
AcuI CTGAAG 1 cut(s) 96
AgsI TTSAA 1 cut(s) 20
AluBI AGCT 2 cut(s) 86, 104
AluI AGCT 2 cut(s) 86, 104
Alw26I GTCTC 1 cut(s) 108
AlwI GGATC 1 cut(s) 79
ApeKI GCWGC 2 cut(s) 11, 104
BbvI GCAGC 2 cut(s) 23, 91
BcoDI GTCTC 1 cut(s) 108
BisI GCNGC 2 cut(s) 12, 105
BlsI GCNGC 2 cut(s) 13, 106
BplI GAGNNNNNCTC 2 cut(s) 25, 57
BpmI CTGGAG 1 cut(s) 47
BpuEI CTTGAG 1 cut(s) 74
BseXI GCAGC 2 cut(s) 23, 91
Bsh1236I CGCG 1 cut(s) 112
BsmAI GTCTC 1 cut(s) 108
BsmBI CGTCTC 1 cut(s) 108
Bsp143I GATC 1 cut(s) 71
Bsp68I TCGCGA 1 cut(s) 112
BspFNI CGCG 1 cut(s) 112
BspPI GGATC 1 cut(s) 79
BssMI GATC 1 cut(s) 71
Bst6I CTCTTC 1 cut(s) 48
BstDEI CTNAG 1 cut(s) 150
BstFNI CGCG 1 cut(s) 112
BstKTI GATC 1 cut(s) 74
BstMAI GTCTC 1 cut(s) 108
BstMBI GATC 1 cut(s) 71
BstUI CGCG 1 cut(s) 112
BstV1I GCAGC 2 cut(s) 23, 91
BstX2I RGATCY 1 cut(s) 71
BstYI RGATCY 1 cut(s) 71
BtuMI TCGCGA 1 cut(s) 112
CviJI RGCY 2 cut(s) 86, 104
CviKI_1 RGCY 2 cut(s) 86, 104
DdeI CTNAG 1 cut(s) 150
DpnI GATC 1 cut(s) 73
DpnII GATC 1 cut(s) 71
Eam1104I CTCTTC 1 cut(s) 48
EarI CTCTTC 1 cut(s) 48
Eco57I CTGAAG 1 cut(s) 96
Esp3I CGTCTC 1 cut(s) 108
FaiI YATR 2 cut(s) 45, 125
Fnu4HI GCNGC 2 cut(s) 12, 105
Fsp4HI GCNGC 2 cut(s) 12, 105
FspEI CC 5 cut(s) 11, 19, 54, 76, 142
GluI GCNGC 2 cut(s) 12, 105
GsuI CTGGAG 1 cut(s) 47
Hpy188I TCNGA 2 cut(s) 64, 76
Hpy188III TCNNGA 2 cut(s) 91, 111
Hpy99I CGWCG 1 cut(s) 68
HpyCH4IV ACGT 1 cut(s) 66
HpyF3I CTNAG 1 cut(s) 150
HpySE526I ACGT 1 cut(s) 66
Kzo9I GATC 1 cut(s) 71
LpnPI CCDG 1 cut(s) 11
Lsp1109I GCAGC 2 cut(s) 23, 91
MaeII ACGT 1 cut(s) 66
MalI GATC 1 cut(s) 73
MboI GATC 1 cut(s) 71
MboII GAAGA 1 cut(s) 65
MflI RGATCY 1 cut(s) 71
MluCI AATT 1 cut(s) 15
MmeI TCCRAC 2 cut(s) 49, 87
MnlI CCTC 1 cut(s) 27
MvnI CGCG 1 cut(s) 112
NdeII GATC 1 cut(s) 71
NruI TCGCGA 1 cut(s) 112
PkrI GCNGC 2 cut(s) 13, 106
PsiI TTATAA 1 cut(s) 125
PsuI RGATCY 1 cut(s) 71
RruI TCGCGA 1 cut(s) 112
SatI GCNGC 2 cut(s) 12, 105
Sau3AI GATC 1 cut(s) 71
SetI ASST 4 cut(s) 69, 88, 106, 161
SgeI CNNG 7 cut(s) 38, 62, 103, 113, 123, 125, 130
SmlI CTYRAG 1 cut(s) 89
SmoI CTYRAG 1 cut(s) 89
Sse9I AATT 1 cut(s) 15
TaiI ACGT 1 cut(s) 69
TaqI TCGA 1 cut(s) 81
TasI AATT 1 cut(s) 15
TseI GCWGC 2 cut(s) 11, 104
TspDTI ATGAA 1 cut(s) 17
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.