MD17G1268400.v1.1

Belongs to the small heat shock protein (HSP20) family

Design Primers CRISPR Design

Basic Information

Type: gene
Biological Identity
malus_domestica
Chr17
OG0007456
Physical Location & Seq
Reverse (-)
32815488 .. 32816815
1328 bp
Loading structure...
UTR
Exon/CDS
Intron
MD17G1268400.v1.1.491

Sequence Viewer

Length: 363 bp
ATGCAAAGGAAGGTAATGGCGGTCTTGTTGACATTGGCGAGAGCAAAGATGCCTACCTTGTTCGAGTTGCACTTGCTGGCCTTCAAACGAATCGAGGTAATGTCAAATGCGTGTAACGTAAAATGTGTTATCCAACGTGACGGAAAGGTTCATATACAAGGAGTCATGAACGGTGTTGAGCTCTTGAAAAACTCATCAACTGTGTACCATATGAGAGCCCAGCAACTATCCTCGCCTGGACCATTTACCCTTTCTTTCAGGCTTCCTGGACCTGTTGACCCCCGTCTGTTTTCTCCTCATTTCCAGCATGATGGAATCCTTGAGATCGTCGTTCTCAAATCCAGCAAATTAAGCAAAAATTGA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
HSP20

Protein Analysis

121

Amino Acids

13.48

Weight (kDa)

10.18

Isoelectric Point (pI)

43.82

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready
iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AciI CCGC 1 cut(s) 20
AfaI GTAC 1 cut(s) 206
AgsI TTSAA 2 cut(s) 85, 187
AjnI CCWGG 2 cut(s) 235, 265
AluBI AGCT 1 cut(s) 181
AluI AGCT 1 cut(s) 181
Alw21I GWGCWC 1 cut(s) 183
AoxI GGCC 1 cut(s) 78
AspS9I GGNCC 2 cut(s) 239, 269
AvaII GGWCC 2 cut(s) 239, 269
BanII GRGCYC 2 cut(s) 183, 220
Bbv12I GWGCWC 1 cut(s) 183
BccI CCATC 1 cut(s) 305
BciT130I CCWGG 2 cut(s) 237, 267
Bme1390I CCNGG 2 cut(s) 237, 267
Bme18I GGWCC 2 cut(s) 239, 269
BmgT120I GGNCC 2 cut(s) 239, 269
BmrFI CCNGG 2 cut(s) 237, 267
BmsI GCATC 1 cut(s) 39
BoxI GACNNNNGTC 1 cut(s) 282
BpuEI CTTGAG 1 cut(s) 341
BseBI CCWGG 2 cut(s) 237, 267
BseRI GAGGAG 1 cut(s) 285
BseYI CCCAGC 1 cut(s) 219
BshFI GGCC 1 cut(s) 80
BsiHKAI GWGCWC 1 cut(s) 183
BsnI GGCC 1 cut(s) 80
Bsp1286I GDGCHC 2 cut(s) 183, 220
Bsp143I GATC 1 cut(s) 324
BspACI CCGC 1 cut(s) 20
BspANI GGCC 1 cut(s) 80
BspHI TCATGA 1 cut(s) 165
BssMI GATC 1 cut(s) 324
Bst2UI CCWGG 2 cut(s) 237, 267
Bst4CI ACNGT 2 cut(s) 173, 202
BstC8I GCNNGC 1 cut(s) 78
BstKTI GATC 1 cut(s) 327
BstMBI GATC 1 cut(s) 324
BstMWI GCNNNNNNNGC 1 cut(s) 351
BstNI CCWGG 2 cut(s) 237, 267
BstPAI GACNNNNGTC 1 cut(s) 282
BstSCI CCNGG 2 cut(s) 235, 265
BstXI CCANNNNNNTGG 1 cut(s) 311
BsuRI GGCC 1 cut(s) 80
Cac8I GCNNGC 1 cut(s) 78
CciI TCATGA 1 cut(s) 165
Cfr13I GGNCC 2 cut(s) 239, 269
Csp6I GTAC 1 cut(s) 205
CviAII CATG 2 cut(s) 166, 308
CviJI RGCY 4 cut(s) 80, 181, 218, 262
CviKI_1 RGCY 4 cut(s) 80, 181, 218, 262
CviQI GTAC 1 cut(s) 205
DpnI GATC 1 cut(s) 326
DpnII GATC 1 cut(s) 324
Ecl136II GAGCTC 1 cut(s) 181
Eco24I GRGCYC 2 cut(s) 183, 220
Eco47I GGWCC 2 cut(s) 239, 269
Eco53kI GAGCTC 1 cut(s) 181
EcoICRI GAGCTC 1 cut(s) 181
EcoRII CCWGG 2 cut(s) 235, 265
EcoT38I GRGCYC 2 cut(s) 183, 220
FaeI CATG 2 cut(s) 169, 311
FaiI YATR 6 cut(s) 153, 155, 167, 210, 212, 309
FatI CATG 2 cut(s) 165, 307
FauNDI CATATG 1 cut(s) 210
FriOI GRGCYC 2 cut(s) 183, 220
GsaI CCCAGC 1 cut(s) 223
HaeIII GGCC 1 cut(s) 80
Hin1II CATG 2 cut(s) 169, 311
HincII GTYRAC 2 cut(s) 30, 277
HindII GTYRAC 2 cut(s) 30, 277
HinfI GANTC 3 cut(s) 90, 162, 315
Hpy166II GTNNAC 3 cut(s) 30, 205, 277
Hpy188III TCNNGA 2 cut(s) 166, 184
Hpy8I GTNNAC 3 cut(s) 30, 205, 277
Hpy99I CGWCG 1 cut(s) 332
HpyAV CCTTC 2 cut(s) 4, 91
HpyCH4III ACNGT 2 cut(s) 173, 202
HpyCH4IV ACGT 2 cut(s) 117, 136
HpyCH4V TGCA 2 cut(s) 4, 70
HpyF10VI GCNNNNNNNGC 1 cut(s) 351
HpySE526I ACGT 2 cut(s) 117, 136
Hsp92II CATG 2 cut(s) 169, 311
Kzo9I GATC 1 cut(s) 324
LweI GCATC 1 cut(s) 39
MaeII ACGT 2 cut(s) 117, 136
MaeIII GTNAC 2 cut(s) 113, 137
MalI GATC 1 cut(s) 326
MboI GATC 1 cut(s) 324
MhlI GDGCHC 2 cut(s) 183, 220
MluCI AATT 2 cut(s) 347, 358
MlyI GAGTC 1 cut(s) 171
MmeI TCCRAC 1 cut(s) 157
MnlI CCTC 3 cut(s) 88, 241, 306
MseI TTAA 1 cut(s) 350
MspR9I CCNGG 2 cut(s) 237, 267
MvaI CCWGG 2 cut(s) 237, 267
MwoI GCNNNNNNNGC 1 cut(s) 351
NdeI CATATG 1 cut(s) 210
NdeII GATC 1 cut(s) 324
NlaIII CATG 2 cut(s) 169, 311
NmuCI GTSAC 1 cut(s) 137
PagI TCATGA 1 cut(s) 165
PfeI GAWTC 2 cut(s) 90, 315
PfoI TCCNGGA 1 cut(s) 265
PleI GAGTC 1 cut(s) 170
PpsI GAGTC 1 cut(s) 170
PshAI GACNNNNGTC 1 cut(s) 282
Psp124BI GAGCTC 1 cut(s) 183
Psp6I CCWGG 2 cut(s) 235, 265
PspFI CCCAGC 1 cut(s) 219
PspGI CCWGG 2 cut(s) 235, 265
PspPI GGNCC 2 cut(s) 239, 269
RsaI GTAC 1 cut(s) 206
RsaNI GTAC 1 cut(s) 205
SacI GAGCTC 1 cut(s) 183
SaqAI TTAA 1 cut(s) 350
Sau3AI GATC 1 cut(s) 324
Sau96I GGNCC 2 cut(s) 239, 269
SchI GAGTC 1 cut(s) 171
ScrFI CCNGG 2 cut(s) 237, 267
SduI GDGCHC 2 cut(s) 183, 220
SetI ASST 8 cut(s) 15, 59, 99, 120, 139, 150, 183, 274
SfaNI GCATC 1 cut(s) 39
SinI GGWCC 2 cut(s) 239, 269
SmlI CTYRAG 1 cut(s) 320
SmoI CTYRAG 1 cut(s) 320
Sse9I AATT 2 cut(s) 347, 358
SsiI CCGC 1 cut(s) 20
SstI GAGCTC 1 cut(s) 183
StyD4I CCNGG 2 cut(s) 235, 265
TaaI ACNGT 2 cut(s) 173, 202
TaiI ACGT 2 cut(s) 120, 139
TaqI TCGA 2 cut(s) 63, 93
TasI AATT 2 cut(s) 347, 358
TfiI GAWTC 2 cut(s) 90, 315
Tru1I TTAA 1 cut(s) 350
Tru9I TTAA 1 cut(s) 350
TseFI GTSAC 1 cut(s) 137
Tsp45I GTSAC 1 cut(s) 137
TspDTI ATGAA 2 cut(s) 140, 182
TspGWI ACGGA 1 cut(s) 156
VpaK11BI GGWCC 2 cut(s) 239, 269
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.