Prupe.1G113700_v2.0.a1

No description available

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp01
Physical Location & Seq
Forward (+)
9030791 .. 9031211
421 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.1G113700.1

Sequence Viewer

Length: 267 bp
ATGATTTATACCTATGATGATAATAAGTTAGTGAAGGAGAGGCTTTGGATAATAAGCATACCTTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATACGTGGGCCAATGGCCCACATGATATTAAATTAATTTCTTTAGGGGGAGGGCTTGCTACAGTAGCTTGCTACTGGAGCTCTCAAGCGTCGCCCAAGCGTTGCACTATTGCATGGGCCTGGCGCACCCCACCAAAACGAGTCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

89

Amino Acids

9.95

Weight (kDa)

9.62

Isoelectric Point (pI)

47.16

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AjnI CCWGG 1 cut(s) 239
AluBI AGCT 2 cut(s) 188, 201
AluI AGCT 2 cut(s) 188, 201
Alw21I GWGCWC 1 cut(s) 203
AoxI GGCC 4 cut(s) 69, 129, 136, 237
AseI ATTAAT 1 cut(s) 155
AspLEI GCGC 1 cut(s) 246
AspS9I GGNCC 3 cut(s) 129, 137, 237
BanII GRGCYC 1 cut(s) 203
Bbv12I GWGCWC 1 cut(s) 203
BciT130I CCWGG 1 cut(s) 241
BfmI CTRYAG 1 cut(s) 180
Bme1390I CCNGG 1 cut(s) 241
BmgT120I GGNCC 3 cut(s) 129, 137, 237
BmrFI CCNGG 1 cut(s) 241
BpmI CTGGAG 1 cut(s) 217
BpuEI CTTGAG 1 cut(s) 189
BsaAI YACGTR 1 cut(s) 126
Bse1I ACTGG 1 cut(s) 200
BseBI CCWGG 1 cut(s) 241
BseNI ACTGG 1 cut(s) 200
BshFI GGCC 4 cut(s) 71, 131, 138, 239
BsiHKAI GWGCWC 1 cut(s) 203
BsnI GGCC 4 cut(s) 71, 131, 138, 239
Bsp1286I GDGCHC 1 cut(s) 203
Bsp143I GATC 1 cut(s) 83
BspANI GGCC 4 cut(s) 71, 131, 138, 239
BsrI ACTGG 1 cut(s) 200
BssMI GATC 1 cut(s) 83
Bst2UI CCWGG 1 cut(s) 241
Bst4CI ACNGT 1 cut(s) 184
BstBAI YACGTR 1 cut(s) 126
BstC8I GCNNGC 2 cut(s) 177, 190
BstDEI CTNAG 1 cut(s) 80
BstHHI GCGC 1 cut(s) 246
BstKTI GATC 1 cut(s) 86
BstMBI GATC 1 cut(s) 83
BstMWI GCNNNNNNNGC 2 cut(s) 185, 198
BstNI CCWGG 1 cut(s) 241
BstSCI CCNGG 1 cut(s) 239
BstSFI CTRYAG 1 cut(s) 180
BsuRI GGCC 4 cut(s) 71, 131, 138, 239
Cac8I GCNNGC 2 cut(s) 177, 190
CfoI GCGC 1 cut(s) 246
Cfr13I GGNCC 3 cut(s) 129, 137, 237
CseI GACGC 1 cut(s) 198
CviAII CATG 2 cut(s) 143, 234
CviJI RGCY 9 cut(s) 43, 71, 79, 131, 138, 175, 188, 201, 239
CviKI_1 RGCY 9 cut(s) 43, 71, 79, 131, 138, 175, 188, 201, 239
DdeI CTNAG 1 cut(s) 80
DpnI GATC 1 cut(s) 85
DpnII GATC 1 cut(s) 83
Ecl136II GAGCTC 1 cut(s) 201
Eco24I GRGCYC 1 cut(s) 203
Eco53kI GAGCTC 1 cut(s) 201
EcoICRI GAGCTC 1 cut(s) 201
EcoRII CCWGG 1 cut(s) 239
EcoT38I GRGCYC 1 cut(s) 203
FaeI CATG 2 cut(s) 146, 237
FaiI YATR 5 cut(s) 9, 15, 59, 144, 235
FalI AAGNNNNNCTT 2 cut(s) 46, 78
FatI CATG 2 cut(s) 142, 233
FriOI GRGCYC 1 cut(s) 203
GlaI GCGC 1 cut(s) 245
GsuI CTGGAG 1 cut(s) 217
HaeIII GGCC 4 cut(s) 71, 131, 138, 239
HgaI GACGC 1 cut(s) 198
HhaI GCGC 1 cut(s) 246
Hin1II CATG 2 cut(s) 146, 237
Hin6I GCGC 1 cut(s) 244
HinP1I GCGC 1 cut(s) 244
HinfI GANTC 1 cut(s) 261
Hpy188I TCNGA 1 cut(s) 121
Hpy99I CGWCG 1 cut(s) 214
HpyAV CCTTC 1 cut(s) 28
HpyCH4III ACNGT 1 cut(s) 184
HpyCH4IV ACGT 1 cut(s) 125
HpyCH4V TGCA 2 cut(s) 225, 233
HpyF10VI GCNNNNNNNGC 2 cut(s) 185, 198
HpyF3I CTNAG 1 cut(s) 80
HpySE526I ACGT 1 cut(s) 125
Hsp92II CATG 2 cut(s) 146, 237
HspAI GCGC 1 cut(s) 244
Kzo9I GATC 1 cut(s) 83
LmnI GCTCC 1 cut(s) 198
LpnPI CCDG 3 cut(s) 181, 226, 253
MaeII ACGT 1 cut(s) 125
MalI GATC 1 cut(s) 85
MboI GATC 1 cut(s) 83
MhlI GDGCHC 1 cut(s) 203
MluCI AATT 2 cut(s) 152, 156
MnlI CCTC 2 cut(s) 33, 164
MseI TTAA 3 cut(s) 113, 150, 155
MspR9I CCNGG 1 cut(s) 241
MvaI CCWGG 1 cut(s) 241
MwoI GCNNNNNNNGC 2 cut(s) 185, 198
NdeII GATC 1 cut(s) 83
NlaIII CATG 2 cut(s) 146, 237
NmeAIII GCCGAG 1 cut(s) 47
Ppu21I YACGTR 1 cut(s) 126
PshBI ATTAAT 1 cut(s) 155
Psp124BI GAGCTC 1 cut(s) 203
Psp6I CCWGG 1 cut(s) 239
PspGI CCWGG 1 cut(s) 239
PspPI GGNCC 3 cut(s) 129, 137, 237
PsrI GAACNNNNNNTAC 2 cut(s) 84, 116
SacI GAGCTC 1 cut(s) 203
SaqAI TTAA 3 cut(s) 113, 150, 155
Sau3AI GATC 1 cut(s) 83
Sau96I GGNCC 3 cut(s) 129, 137, 237
ScrFI CCNGG 1 cut(s) 241
SduI GDGCHC 1 cut(s) 203
SetI ASST 5 cut(s) 14, 64, 128, 190, 203
SfcI CTRYAG 1 cut(s) 180
SmlI CTYRAG 1 cut(s) 204
SmoI CTYRAG 1 cut(s) 204
Sse9I AATT 2 cut(s) 152, 156
SstI GAGCTC 1 cut(s) 203
StyD4I CCNGG 1 cut(s) 239
TaaI ACNGT 1 cut(s) 184
TaiI ACGT 1 cut(s) 128
TasI AATT 2 cut(s) 152, 156
Tru1I TTAA 3 cut(s) 113, 150, 155
Tru9I TTAA 3 cut(s) 113, 150, 155
VspI ATTAAT 1 cut(s) 155
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.