Prupe.8G172200_v2.0.a1

No description available

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp08
Physical Location & Seq
Reverse (-)
17590675 .. 17590914
240 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.8G172200.1

Sequence Viewer

Length: 240 bp
GAGAAAGAAGAGAAAAGAATAAGCATACCTTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATACGTGGGCCAATGGTCCACACGATATTAAATTAATTTCTTTAGGGGGAGGGTCCATCACAGTAGCTTGCTATTGGGACTCTCGTGTGTCGCCCAAGCGTTGCACTATTGCATGGGCCTGGCGCTCCCCACCAAATCCAGTTCAAAATTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

80

Amino Acids

8.83

Weight (kDa)

9.24

Isoelectric Point (pI)

62.24

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AgsI TTSAA 1 cut(s) 233
AjnI CCWGG 1 cut(s) 206
AluBI AGCT 1 cut(s) 155
AluI AGCT 1 cut(s) 155
AoxI GGCC 3 cut(s) 36, 96, 204
AseI ATTAAT 1 cut(s) 122
AspLEI GCGC 1 cut(s) 213
AspS9I GGNCC 4 cut(s) 96, 104, 141, 204
AvaII GGWCC 2 cut(s) 104, 141
BauI CACGAG 1 cut(s) 171
BccI CCATC 1 cut(s) 152
BciT130I CCWGG 1 cut(s) 208
BfoI RGCGCY 1 cut(s) 214
Bme1390I CCNGG 1 cut(s) 208
Bme18I GGWCC 2 cut(s) 104, 141
BmgT120I GGNCC 4 cut(s) 96, 104, 141, 204
BmiI GGNNCC 1 cut(s) 142
BmrFI CCNGG 1 cut(s) 208
BsaAI YACGTR 1 cut(s) 93
Bse1I ACTGG 1 cut(s) 227
BseBI CCWGG 1 cut(s) 208
BseNI ACTGG 1 cut(s) 227
BshFI GGCC 3 cut(s) 38, 98, 206
BslFI GGGAC 1 cut(s) 179
BsmFI GGGAC 1 cut(s) 179
BsnI GGCC 3 cut(s) 38, 98, 206
Bsp143I GATC 1 cut(s) 50
BspANI GGCC 3 cut(s) 38, 98, 206
BspLI GGNNCC 1 cut(s) 142
BsrI ACTGG 1 cut(s) 227
BssMI GATC 1 cut(s) 50
BssSI CACGAG 1 cut(s) 171
Bst2BI CACGAG 1 cut(s) 171
Bst2UI CCWGG 1 cut(s) 208
Bst4CI ACNGT 1 cut(s) 151
Bst6I CTCTTC 1 cut(s) 3
BstBAI YACGTR 1 cut(s) 93
BstC8I GCNNGC 1 cut(s) 157
BstDEI CTNAG 1 cut(s) 47
BstH2I RGCGCY 1 cut(s) 214
BstHHI GCGC 1 cut(s) 213
BstKTI GATC 1 cut(s) 53
BstMBI GATC 1 cut(s) 50
BstNI CCWGG 1 cut(s) 208
BstSCI CCNGG 1 cut(s) 206
BsuRI GGCC 3 cut(s) 38, 98, 206
Cac8I GCNNGC 1 cut(s) 157
CfoI GCGC 1 cut(s) 213
Cfr13I GGNCC 4 cut(s) 96, 104, 141, 204
CviAII CATG 1 cut(s) 201
CviJI RGCY 5 cut(s) 38, 46, 98, 155, 206
CviKI_1 RGCY 5 cut(s) 38, 46, 98, 155, 206
DdeI CTNAG 1 cut(s) 47
DpnI GATC 1 cut(s) 52
DpnII GATC 1 cut(s) 50
Eam1104I CTCTTC 1 cut(s) 3
EarI CTCTTC 1 cut(s) 3
Eco47I GGWCC 2 cut(s) 104, 141
EcoRII CCWGG 1 cut(s) 206
FaeI CATG 1 cut(s) 204
FaiI YATR 2 cut(s) 26, 202
FalI AAGNNNNNCTT 2 cut(s) 13, 45
FaqI GGGAC 1 cut(s) 179
FatI CATG 1 cut(s) 200
GlaI GCGC 1 cut(s) 212
HaeII RGCGCY 1 cut(s) 214
HaeIII GGCC 3 cut(s) 38, 98, 206
HhaI GCGC 1 cut(s) 213
Hin1II CATG 1 cut(s) 204
Hin6I GCGC 1 cut(s) 211
HinP1I GCGC 1 cut(s) 211
HinfI GANTC 1 cut(s) 167
Hpy166II GTNNAC 1 cut(s) 107
Hpy188I TCNGA 1 cut(s) 88
Hpy8I GTNNAC 1 cut(s) 107
HpyCH4III ACNGT 1 cut(s) 151
HpyCH4IV ACGT 1 cut(s) 92
HpyCH4V TGCA 2 cut(s) 192, 200
HpyF3I CTNAG 1 cut(s) 47
HpySE526I ACGT 1 cut(s) 92
Hsp92II CATG 1 cut(s) 204
HspAI GCGC 1 cut(s) 211
Kzo9I GATC 1 cut(s) 50
LmnI GCTCC 1 cut(s) 218
LpnPI CCDG 2 cut(s) 193, 220
MaeII ACGT 1 cut(s) 92
MalI GATC 1 cut(s) 52
MboI GATC 1 cut(s) 50
MboII GAAGA 1 cut(s) 20
MluCI AATT 3 cut(s) 119, 123, 235
MlyI GAGTC 1 cut(s) 161
MnlI CCTC 1 cut(s) 131
MseI TTAA 4 cut(s) 80, 117, 122, 238
MspR9I CCNGG 1 cut(s) 208
MvaI CCWGG 1 cut(s) 208
NdeII GATC 1 cut(s) 50
NlaIII CATG 1 cut(s) 204
NlaIV GGNNCC 1 cut(s) 142
NmeAIII GCCGAG 1 cut(s) 14
PleI GAGTC 1 cut(s) 161
PpsI GAGTC 1 cut(s) 161
Ppu21I YACGTR 1 cut(s) 93
PshBI ATTAAT 1 cut(s) 122
Psp6I CCWGG 1 cut(s) 206
PspGI CCWGG 1 cut(s) 206
PspN4I GGNNCC 1 cut(s) 142
PspPI GGNCC 4 cut(s) 96, 104, 141, 204
PsrI GAACNNNNNNTAC 2 cut(s) 51, 83
SaqAI TTAA 4 cut(s) 80, 117, 122, 238
Sau3AI GATC 1 cut(s) 50
Sau96I GGNCC 4 cut(s) 96, 104, 141, 204
SchI GAGTC 1 cut(s) 161
ScrFI CCNGG 1 cut(s) 208
SetI ASST 3 cut(s) 31, 95, 157
SinI GGWCC 2 cut(s) 104, 141
Sse9I AATT 3 cut(s) 119, 123, 235
StyD4I CCNGG 1 cut(s) 206
TaaI ACNGT 1 cut(s) 151
TaiI ACGT 1 cut(s) 95
TasI AATT 3 cut(s) 119, 123, 235
Tru1I TTAA 4 cut(s) 80, 117, 122, 238
Tru9I TTAA 4 cut(s) 80, 117, 122, 238
VpaK11BI GGWCC 2 cut(s) 104, 141
VspI ATTAAT 1 cut(s) 122
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.