Prupe.6G338200_v2.0.a1

No description available

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp06
Physical Location & Seq
Forward (+)
29321382 .. 29321524
143 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.6G338200.1

Sequence Viewer

Length: 102 bp
ATGGGTGATCAAGAAGGCCCATGGCCTAGGTTGGTGACCTCCATTGCACTTAGGAGGGGTGCCTGCCTATGGTCTCCTCAAGTAGGAGAGCCAATGTCATAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

34

Amino Acids

3.63

Weight (kDa)

5.94

Isoelectric Point (pI)

83.05

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AccB1I GGYRCC 1 cut(s) 59
AfiI CCNNNNNNNGG 2 cut(s) 69, 83
Alw26I GTCTC 1 cut(s) 78
AoxI GGCC 2 cut(s) 16, 23
AspA2I CCTAGG 1 cut(s) 26
AspS9I GGNCC 1 cut(s) 17
AsuHPI GGTGA 2 cut(s) 17, 46
AvrII CCTAGG 1 cut(s) 26
BanI GGYRCC 1 cut(s) 59
BclI TGATCA 1 cut(s) 7
BcoDI GTCTC 1 cut(s) 78
BfaI CTAG 1 cut(s) 27
BlnI CCTAGG 1 cut(s) 26
BmgT120I GGNCC 1 cut(s) 17
BmiI GGNNCC 1 cut(s) 61
BpuEI CTTGAG 1 cut(s) 63
BsaI GGTCTC 1 cut(s) 78
BsaJI CCNNGG 2 cut(s) 20, 26
Bsc4I CCNNNNNNNGG 2 cut(s) 69, 83
Bse3DI GCAATG 1 cut(s) 42
BseDI CCNNGG 2 cut(s) 20, 26
BseLI CCNNNNNNNGG 2 cut(s) 69, 83
BseMI GCAATG 1 cut(s) 42
BseRI GAGGAG 1 cut(s) 66
BshFI GGCC 2 cut(s) 18, 25
BshNI GGYRCC 1 cut(s) 59
BslI CCNNNNNNNGG 2 cut(s) 69, 83
BsmAI GTCTC 1 cut(s) 78
BsnI GGCC 2 cut(s) 18, 25
Bso31I GGTCTC 1 cut(s) 78
Bsp143I GATC 1 cut(s) 7
Bsp19I CCATGG 1 cut(s) 20
BspANI GGCC 2 cut(s) 18, 25
BspLI GGNNCC 1 cut(s) 61
BspT107I GGYRCC 1 cut(s) 59
BspTNI GGTCTC 1 cut(s) 78
BsrDI GCAATG 1 cut(s) 42
BssECI CCNNGG 2 cut(s) 20, 26
BssMI GATC 1 cut(s) 7
BssT1I CCWWGG 2 cut(s) 20, 26
BstC8I GCNNGC 1 cut(s) 64
BstDEI CTNAG 1 cut(s) 50
BstDSI CCRYGG 1 cut(s) 20
BstEII GGTNACC 1 cut(s) 34
BstENI CCTNNNNNAGG 1 cut(s) 81
BstKTI GATC 1 cut(s) 10
BstMAI GTCTC 1 cut(s) 78
BstMBI GATC 1 cut(s) 7
BstPI GGTNACC 1 cut(s) 34
BsuRI GGCC 2 cut(s) 18, 25
BtgI CCRYGG 1 cut(s) 20
Cac8I GCNNGC 1 cut(s) 64
Cfr13I GGNCC 1 cut(s) 17
CviAII CATG 1 cut(s) 21
CviJI RGCY 3 cut(s) 18, 25, 91
CviKI_1 RGCY 3 cut(s) 18, 25, 91
DdeI CTNAG 1 cut(s) 50
DpnI GATC 1 cut(s) 9
DpnII GATC 1 cut(s) 7
Eco130I CCWWGG 2 cut(s) 20, 26
Eco31I GGTCTC 1 cut(s) 78
Eco91I GGTNACC 1 cut(s) 34
EcoNI CCTNNNNNAGG 1 cut(s) 81
EcoO65I GGTNACC 1 cut(s) 34
EcoT14I CCWWGG 2 cut(s) 20, 26
ErhI CCWWGG 2 cut(s) 20, 26
FaeI CATG 1 cut(s) 24
FaiI YATR 3 cut(s) 22, 70, 100
FatI CATG 1 cut(s) 20
FbaI TGATCA 1 cut(s) 7
FspBI CTAG 1 cut(s) 27
HaeIII GGCC 2 cut(s) 18, 25
Hin1II CATG 1 cut(s) 24
HphI GGTGA 2 cut(s) 17, 46
Hpy188III TCNNGA 1 cut(s) 11
HpyAV CCTTC 1 cut(s) 8
HpyCH4V TGCA 1 cut(s) 47
HpyF3I CTNAG 1 cut(s) 50
Hsp92II CATG 1 cut(s) 24
Ksp22I TGATCA 1 cut(s) 7
Kzo9I GATC 1 cut(s) 7
LpnPI CCDG 1 cut(s) 76
MaeI CTAG 1 cut(s) 27
MaeIII GTNAC 1 cut(s) 34
MalI GATC 1 cut(s) 9
MboI GATC 1 cut(s) 7
MnlI CCTC 3 cut(s) 48, 49, 87
NcoI CCATGG 1 cut(s) 20
NdeII GATC 1 cut(s) 7
NlaIII CATG 1 cut(s) 24
NlaIV GGNNCC 1 cut(s) 61
NmuCI GTSAC 1 cut(s) 34
PspEI GGTNACC 1 cut(s) 34
PspN4I GGNNCC 1 cut(s) 61
PspPI GGNCC 1 cut(s) 17
Sau3AI GATC 1 cut(s) 7
Sau96I GGNCC 1 cut(s) 17
SetI ASST 2 cut(s) 32, 41
SgeI CNNG 5 cut(s) 23, 33, 39, 75, 92
SmlI CTYRAG 1 cut(s) 78
SmoI CTYRAG 1 cut(s) 78
SspMI CTAG 1 cut(s) 27
StyI CCWWGG 2 cut(s) 20, 26
TseFI GTSAC 1 cut(s) 34
Tsp45I GTSAC 1 cut(s) 34
XagI CCTNNNNNAGG 1 cut(s) 81
XmaJI CCTAGG 1 cut(s) 26
XspI CTAG 1 cut(s) 27
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.