Basic Information

Type: gene

Biological Identity

Species

prunus_persica

Chromosome

Pp01

Orthogroup ID

OG0015714

Physical Location & Seq

Genomic Coordinates Forward (+)

10698444 .. 10700506

Gene Structure 2063 bp

Loading structure...

UTR

Exon/CDS

Intron

Transcript / Protein ID

Prupe.1G136100.1

Sequence Viewer

CDS Protein Promoter (2k)

Length: 234 bp

ATGAGCGATCAAGAAGGCTCATGGCCTAGGTTGGTGACCTCCATTGCACTTAGGAGGGGTTCCCGCCTATGGTCTCCTCAACAGAAACAAGAGAAGAGAAAAGGCATACCTTTCTCGGCCTTTTGGCTAAGATCAAGTGTAGTATCTGTTCTGATCAGTTTAATATCTGATATGTGGGTCAATGACCCACACGATATTAAATTAATTTCTCTAGGGGAGGGTCCGCTACAGTAG

Functional Annotation

Gene Ontology

Molecular Function
Biological Process
Cellular Component

No ontology terms assigned.

KEGG Pathways

Metabolic & Signaling

No pathways identified.

Pfam Domains

Protein Families

No domains found.

Protein Analysis

78

Amino Acids

8.76

Weight (kDa)

9.98

Isoelectric Point (pI)

63.11

Instability Index

Protein Domains (Pfam)

No Pfam domains detected for this protein.

Hydrophobicity Profile (Kyte-Doolittle)

AI Structure Prediction Report

Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter

Style Settings

Font Size (px)

Line Width

Align Labels (Cladogram)

Image

Tree File

Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

iTOL Interactive Tree Of Life · Most popular EvolView Flexible annotations MEGA Desktop phylogenetics suite FigTree Desktop tree editor

Orthologous Genes (Group: OG0015714)

Species	Orthologous Gene IDs
prunus_persica	Prupe.1G098500_v2.0.a1 Prupe.1G113700_v2.0.a1 Prupe.1G117400_v2.0.a1 Prupe.1G135800_v2.0.a1 Prupe.1G136000_v2.0.a1 Prupe.1G136100_v2.0.a1 Prupe.1G136200_v2.0.a1 Prupe.1G232200_v2.0.a1 Prupe.1G384200_v2.0.a1 Prupe.2G064500_v2.0.a1 Prupe.2G226800_v2.0.a1 Prupe.6G338200_v2.0.a1 Prupe.8G172200_v2.0.a1
pyrus_communis	pycom04g19430 pycom16g14190
rosa_laevigata	RLG00000025384

Restriction Enzyme Sites

1 / 10

Enzyme	Recognition Site	Cut Count	Positions (bp)
AciI	CCGC	2 cut(s)	64, 224
AfiI	CCNNNNNNNGG	1 cut(s)	69
Alw26I	GTCTC	1 cut(s)	78
AoxI	GGCC	2 cut(s)	23, 117
AseI	ATTAAT	1 cut(s)	203
AspA2I	CCTAGG	1 cut(s)	26
AspS9I	GGNCC	1 cut(s)	221
AsuHPI	GGTGA	1 cut(s)	46
AvaII	GGWCC	1 cut(s)	221
AvrII	CCTAGG	1 cut(s)	26
BclI	TGATCA	1 cut(s)	153
BcoDI	GTCTC	1 cut(s)	78
BfaI	CTAG	2 cut(s)	27, 212
BfmI	CTRYAG	1 cut(s)	227
BlnI	CCTAGG	1 cut(s)	26
Bme18I	GGWCC	1 cut(s)	221
BmgT120I	GGNCC	1 cut(s)	221
BmiI	GGNNCC	2 cut(s)	61, 222
BsaI	GGTCTC	1 cut(s)	78
BsaJI	CCNNGG	1 cut(s)	26
Bsc4I	CCNNNNNNNGG	1 cut(s)	69
Bse3DI	GCAATG	1 cut(s)	42
BseDI	CCNNGG	1 cut(s)	26
BseLI	CCNNNNNNNGG	1 cut(s)	69
BseMI	GCAATG	1 cut(s)	42
BseRI	GAGGAG	1 cut(s)	66
BshFI	GGCC	2 cut(s)	25, 119
BslI	CCNNNNNNNGG	1 cut(s)	69
BsmAI	GTCTC	1 cut(s)	78
BsnI	GGCC	2 cut(s)	25, 119
Bso31I	GGTCTC	1 cut(s)	78
Bsp143I	GATC	3 cut(s)	7, 131, 153
BspACI	CCGC	2 cut(s)	64, 224
BspANI	GGCC	2 cut(s)	25, 119
BspLI	GGNNCC	2 cut(s)	61, 222
BspTNI	GGTCTC	1 cut(s)	78
BsrDI	GCAATG	1 cut(s)	42
BssECI	CCNNGG	1 cut(s)	26
BssMI	GATC	3 cut(s)	7, 131, 153
BssT1I	CCWWGG	1 cut(s)	26
Bst4CI	ACNGT	1 cut(s)	231
Bst6I	CTCTTC	1 cut(s)	89
BstDEI	CTNAG	2 cut(s)	50, 128
BstEII	GGTNACC	1 cut(s)	34
BstKTI	GATC	3 cut(s)	10, 134, 156
BstMAI	GTCTC	1 cut(s)	78
BstMBI	GATC	3 cut(s)	7, 131, 153
BstPI	GGTNACC	1 cut(s)	34
BstSFI	CTRYAG	1 cut(s)	227
BsuRI	GGCC	2 cut(s)	25, 119
Cfr13I	GGNCC	1 cut(s)	221
CviAII	CATG	1 cut(s)	21
CviJI	RGCY	4 cut(s)	18, 25, 119, 127
CviKI_1	RGCY	4 cut(s)	18, 25, 119, 127
DdeI	CTNAG	2 cut(s)	50, 128
DpnI	GATC	3 cut(s)	9, 133, 155
DpnII	GATC	3 cut(s)	7, 131, 153
Eam1104I	CTCTTC	1 cut(s)	89
EarI	CTCTTC	1 cut(s)	89
Eco130I	CCWWGG	1 cut(s)	26
Eco31I	GGTCTC	1 cut(s)	78
Eco47I	GGWCC	1 cut(s)	221
Eco91I	GGTNACC	1 cut(s)	34
EcoO65I	GGTNACC	1 cut(s)	34
EcoT14I	CCWWGG	1 cut(s)	26
ErhI	CCWWGG	1 cut(s)	26
FaeI	CATG	1 cut(s)	24
FaiI	YATR	4 cut(s)	22, 70, 107, 173
FatI	CATG	1 cut(s)	20
FauI	CCCGC	1 cut(s)	71
FbaI	TGATCA	1 cut(s)	153
FspBI	CTAG	2 cut(s)	27, 212
HaeIII	GGCC	2 cut(s)	25, 119
Hin1II	CATG	1 cut(s)	24
HphI	GGTGA	1 cut(s)	46
Hpy188I	TCNGA	2 cut(s)	153, 169
Hpy188III	TCNNGA	1 cut(s)	11
HpyAV	CCTTC	1 cut(s)	8
HpyCH4III	ACNGT	1 cut(s)	231
HpyCH4V	TGCA	1 cut(s)	47
HpyF3I	CTNAG	2 cut(s)	50, 128
Hsp92II	CATG	1 cut(s)	24
Ksp22I	TGATCA	1 cut(s)	153
Kzo9I	GATC	3 cut(s)	7, 131, 153
MaeI	CTAG	2 cut(s)	27, 212
MaeIII	GTNAC	1 cut(s)	34
MalI	GATC	3 cut(s)	9, 133, 155
MboI	GATC	3 cut(s)	7, 131, 153
MboII	GAAGA	1 cut(s)	106
MluCI	AATT	2 cut(s)	200, 204
MnlI	CCTC	4 cut(s)	48, 49, 87, 211
MseI	TTAA	3 cut(s)	161, 198, 203
NdeII	GATC	3 cut(s)	7, 131, 153
NlaIII	CATG	1 cut(s)	24
NlaIV	GGNNCC	2 cut(s)	61, 222
NmeAIII	GCCGAG	1 cut(s)	95
NmuCI	GTSAC	1 cut(s)	34
PshBI	ATTAAT	1 cut(s)	203
PspEI	GGTNACC	1 cut(s)	34
PspN4I	GGNNCC	2 cut(s)	61, 222
PspPI	GGNCC	1 cut(s)	221
PsrI	GAACNNNNNNTAC	2 cut(s)	132, 164
SaqAI	TTAA	3 cut(s)	161, 198, 203
Sau3AI	GATC	3 cut(s)	7, 131, 153
Sau96I	GGNCC	1 cut(s)	221
SetI	ASST	3 cut(s)	32, 41, 112
SfcI	CTRYAG	1 cut(s)	227
SgeI	CNNG	9 cut(s)	23, 33, 39, 75, 101, 127, 147, 203, 224
SinI	GGWCC	1 cut(s)	221
Sse9I	AATT	2 cut(s)	200, 204
SsiI	CCGC	2 cut(s)	64, 224
SspMI	CTAG	2 cut(s)	27, 212
StyI	CCWWGG	1 cut(s)	26
TaaI	ACNGT	1 cut(s)	231
TasI	AATT	2 cut(s)	200, 204
Tru1I	TTAA	3 cut(s)	161, 198, 203
Tru9I	TTAA	3 cut(s)	161, 198, 203
TseFI	GTSAC	1 cut(s)	34
Tsp45I	GTSAC	1 cut(s)	34
VpaK11BI	GGWCC	1 cut(s)	221
VspI	ATTAAT	1 cut(s)	203
XmaJI	CCTAGG	1 cut(s)	26
XspI	CTAG	2 cut(s)	27, 212

Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.