Prupe.1G136200_v2.0.a1

No description available

Basic Information

Type: gene
Biological Identity
prunus_persica
Pp01
Physical Location & Seq
Forward (+)
10704251 .. 10704612
362 bp
Loading structure...
UTR
Exon/CDS
Intron
Prupe.1G136200.1

Sequence Viewer

Length: 333 bp
ATGTATGCATGCATAACCCAAATCAATTATGCTCTCAGCCTTCGTAGCCCCCTTTTGCTTTTTGTAACTGTTGAACAGTCCCACATCGACTGGACCAATAACCATGGAAGTGAATGGCCCGATAAAAAGAGAAACAAGAGATGTGAAAAATCAAGTGTAGTATCTGTTCTTATCAGTTTAATATCTGATATGTGGGTCAATGACCCACACGATATTAAATTAATTTCTTTAGGGGGAGGGTTCGCTACGGTAGCTTGCTATTGGGGCTCTCAAGTGTCGCTCAAGCGTTGCACTATTGCAGGGGCCTGGCGCACCCCACTAAATTTAGTCTAA
Functional Annotation
Gene Ontology
Molecular Function
Biological Process
Cellular Component
No ontology terms assigned.
KEGG Pathways
Metabolic & Signaling
No pathways identified.
Pfam Domains
Protein Families
No domains found.

Protein Analysis

111

Amino Acids

12.37

Weight (kDa)

8.78

Isoelectric Point (pI)

52.08

Instability Index
Protein Domains (Pfam)
No Pfam domains detected for this protein.
Hydrophobicity Profile (Kyte-Doolittle)
AI Structure Prediction Report
Calculating structure properties...

Genomic Context

Gene Family Tree

Species Filter
Loading...
Style Settings
Image
Tree File
Tip: Beautify your tree with professional tools

Download the Full Tree (.nwk) file, then upload it to any of the following tools to customize colors, fonts, annotations, clades, and branch support.

Publication-ready

Restriction Enzyme Sites

1 / 10
Enzyme Recognition Site Cut Count Positions (bp)
AcsI RAATTY 1 cut(s) 322
AgsI TTSAA 1 cut(s) 74
AjnI CCWGG 1 cut(s) 305
AluBI AGCT 1 cut(s) 254
AluI AGCT 1 cut(s) 254
AoxI GGCC 2 cut(s) 116, 303
ApoI RAATTY 1 cut(s) 322
AseI ATTAAT 1 cut(s) 221
AspLEI GCGC 1 cut(s) 312
AspS9I GGNCC 3 cut(s) 93, 117, 303
AvaII GGWCC 1 cut(s) 93
BanII GRGCYC 1 cut(s) 269
BciT130I CCWGG 1 cut(s) 307
Bme1390I CCNGG 1 cut(s) 307
Bme18I GGWCC 1 cut(s) 93
BmgT120I GGNCC 3 cut(s) 93, 117, 303
BmiI GGNNCC 1 cut(s) 304
BmrFI CCNGG 1 cut(s) 307
BpuEI CTTGAG 2 cut(s) 255, 266
BsaJI CCNNGG 1 cut(s) 103
Bse1I ACTGG 1 cut(s) 95
BseBI CCWGG 1 cut(s) 307
BseDI CCNNGG 1 cut(s) 103
BseMII CTCAG 1 cut(s) 49
BseNI ACTGG 1 cut(s) 95
BshFI GGCC 2 cut(s) 118, 305
BslFI GGGAC 1 cut(s) 64
BsmFI GGGAC 1 cut(s) 64
BsnI GGCC 2 cut(s) 118, 305
Bsp1286I GDGCHC 1 cut(s) 269
Bsp19I CCATGG 1 cut(s) 103
BspANI GGCC 2 cut(s) 118, 305
BspCNI CTCAG 1 cut(s) 48
BspLI GGNNCC 1 cut(s) 304
BsrI ACTGG 1 cut(s) 95
BssECI CCNNGG 1 cut(s) 103
BssT1I CCWWGG 1 cut(s) 103
Bst2UI CCWGG 1 cut(s) 307
Bst4CI ACNGT 3 cut(s) 70, 78, 250
BstC8I GCNNGC 2 cut(s) 10, 256
BstDEI CTNAG 1 cut(s) 35
BstDSI CCRYGG 1 cut(s) 103
BstHHI GCGC 1 cut(s) 312
BstMWI GCNNNNNNNGC 3 cut(s) 45, 251, 264
BstNI CCWGG 1 cut(s) 307
BstNSI RCATGY 1 cut(s) 12
BstSCI CCNGG 1 cut(s) 305
BsuRI GGCC 2 cut(s) 118, 305
BtgI CCRYGG 1 cut(s) 103
Cac8I GCNNGC 2 cut(s) 10, 256
CfoI GCGC 1 cut(s) 312
Cfr13I GGNCC 3 cut(s) 93, 117, 303
CviAII CATG 2 cut(s) 9, 104
CviJI RGCY 6 cut(s) 39, 48, 118, 254, 267, 305
CviKI_1 RGCY 6 cut(s) 39, 48, 118, 254, 267, 305
DdeI CTNAG 1 cut(s) 35
Eco130I CCWWGG 1 cut(s) 103
Eco24I GRGCYC 1 cut(s) 269
Eco47I GGWCC 1 cut(s) 93
EcoO109I RGGNCCY 1 cut(s) 303
EcoRII CCWGG 1 cut(s) 305
EcoT14I CCWWGG 1 cut(s) 103
EcoT22I ATGCAT 2 cut(s) 10, 14
EcoT38I GRGCYC 1 cut(s) 269
ErhI CCWWGG 1 cut(s) 103
FaeI CATG 2 cut(s) 12, 107
FaiI YATR 6 cut(s) 6, 10, 14, 30, 105, 191
FaqI GGGAC 1 cut(s) 64
FatI CATG 2 cut(s) 8, 103
FriOI GRGCYC 1 cut(s) 269
GlaI GCGC 1 cut(s) 311
HaeIII GGCC 2 cut(s) 118, 305
HhaI GCGC 1 cut(s) 312
Hin1II CATG 2 cut(s) 12, 107
Hin6I GCGC 1 cut(s) 310
HinP1I GCGC 1 cut(s) 310
Hpy188I TCNGA 1 cut(s) 187
HpyAV CCTTC 1 cut(s) 50
HpyCH4III ACNGT 3 cut(s) 70, 78, 250
HpyCH4V TGCA 4 cut(s) 8, 12, 291, 299
HpyF10VI GCNNNNNNNGC 3 cut(s) 45, 251, 264
HpyF3I CTNAG 1 cut(s) 35
Hsp92II CATG 2 cut(s) 12, 107
HspAI GCGC 1 cut(s) 310
LpnPI CCDG 4 cut(s) 76, 285, 292, 319
MaeIII GTNAC 1 cut(s) 64
MhlI GDGCHC 1 cut(s) 269
MluCI AATT 4 cut(s) 25, 218, 222, 322
MnlI CCTC 1 cut(s) 230
Mph1103I ATGCAT 2 cut(s) 10, 14
MseI TTAA 3 cut(s) 179, 216, 221
MslI CAYNNNNRTG 1 cut(s) 108
MspR9I CCNGG 1 cut(s) 307
MvaI CCWGG 1 cut(s) 307
MwoI GCNNNNNNNGC 3 cut(s) 45, 251, 264
NcoI CCATGG 1 cut(s) 103
NlaIII CATG 2 cut(s) 12, 107
NlaIV GGNNCC 1 cut(s) 304
NsiI ATGCAT 2 cut(s) 10, 14
NspI RCATGY 1 cut(s) 12
PaeI GCATGC 1 cut(s) 12
PshBI ATTAAT 1 cut(s) 221
Psp6I CCWGG 1 cut(s) 305
PspGI CCWGG 1 cut(s) 305
PspN4I GGNNCC 1 cut(s) 304
PspPI GGNCC 3 cut(s) 93, 117, 303
PsrI GAACNNNNNNTAC 2 cut(s) 150, 182
RseI CAYNNNNRTG 1 cut(s) 108
SaqAI TTAA 3 cut(s) 179, 216, 221
Sau96I GGNCC 3 cut(s) 93, 117, 303
ScrFI CCNGG 1 cut(s) 307
SduI GDGCHC 1 cut(s) 269
SetI ASST 1 cut(s) 256
SinI GGWCC 1 cut(s) 93
SmiMI CAYNNNNRTG 1 cut(s) 108
SmlI CTYRAG 2 cut(s) 270, 281
SmoI CTYRAG 2 cut(s) 270, 281
SphI GCATGC 1 cut(s) 12
Sse9I AATT 4 cut(s) 25, 218, 222, 322
StyD4I CCNGG 1 cut(s) 305
StyI CCWWGG 1 cut(s) 103
TaaI ACNGT 3 cut(s) 70, 78, 250
TaqI TCGA 1 cut(s) 87
TasI AATT 4 cut(s) 25, 218, 222, 322
Tru1I TTAA 3 cut(s) 179, 216, 221
Tru9I TTAA 3 cut(s) 179, 216, 221
VpaK11BI GGWCC 1 cut(s) 93
VspI ATTAAT 1 cut(s) 221
XapI RAATTY 1 cut(s) 322
XceI RCATGY 1 cut(s) 12
Zsp2I ATGCAT 2 cut(s) 10, 14
Using CommOnly database (standard laboratory enzymes). Scanned on CDS sequence.